Basic Information

Symbol
OLIG2
RNA class
mRNA
Alias
Oligodendrocyte Transcription Factor 2 BHLHe19 RACK17 PRKCBP2 OLIGO2 BHLHB1 Oligodendrocyte-Specific BHLH Transcription Factor 2 Basic Domain, Helix-Loop-Helix Protein, Class B, 1 Oligodendrocyte Lineage Transcription Factor 2 Human Protein Kinase C-Binding Protein RACK17 Class E Basic Helix-Loop-Helix Protein 19 Class B Basic Helix-Loop-Helix Protein 1 Protein Kinase C-Binding Protein 2 Protein Kinase C-Binding Protein RACK17 Protein Kinase C Binding Protein 2 BHLHE19 Oligo2 BHLHb1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005806.4
Sequence length
2477.0 nt
GC content
0.5943

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1049.90 kcal/mol
Thermodynamic ensemble
Free energy: -1092.38 kcal/mol
Frequency: 0.0000
Diversity: 678.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((............((((.(((((..((.(((((((..((((.((.(((((..((((((.(((((((..........)))).)))....(((((((.(((..(((((((((......((...(((((((((((............((((...((.((.((((((((...))))))))))))))))))))))))...))).))....)))))))))..)))))))))).))))))..))).)).)).)))).))))))).))...)))))..))))(((.....)))..(((((((.((((((.(((((((.......)))))))...))))))))))))).)))))).(((((...(((..(((((....))))).)))..)))))(((((((((.(((((((.((..((((.(((((.((((((((((........))))...........((((((((((.(((((...))))).))...............((.(((((.((.(((((.((....((((......((.((((((((((((...)))))))).))))..))...((((......((((((..((..((...))..))...(((((((((((.((((..........((.(((((((((..(((((...........))))).))))))))).))...((((((((((......)))))....))))).((...(((((((.(.(((((.....)))))...).)))))))..))))))..))))))))))).)))))))))).......(((((((((...((.(((((..(((..((((.(((((((.((((((((.((....)).)))))))).((((....))))........(((((....))))).(((((((((.(((.......))).)))).)))))...........((((.((((((((((..(((((((.....)))))))..))))))))))))))))).))))))))...)))...))))).))....(((((((((((..(((((((((.(((((((.((..((..(((...(((((((...(((((((.((((...))))))))).))...)))))))...))).))))..))))))))))))))....))..))))))...))))))))))))))....))))....)).))))))).))))))).))))))))..((((((((((((((((.((((...((((((.(((((.((((.(((......((.((((((..((((.....))))..).(((((......))))).((((((((.((((.(.(..(((.((((..(((((((.((((((.((...(((......)))..)))))))).)))))...))..)))).)))..).).))))))))))))....(((((((.((((((..((((((((((((((.(((((...........))))).)))).))).))).(((((..(((.(.(((.....)))).)))..)))))))))..))))))((((.((((((((((......(((((...)))))...)))))))))).)))))))))))......(((....)))....))))).)).....))).)))).)))))........((((((((((...))))))))))..((((.(((..((((((((((.......(((((.....)))))((......))............((((((((((((((........((((.......))))(((((.(((.......)))..)))))....(((((((((......(((((((((((((...((.....))...)))))..)))))))).......)).)))))))..))))))))).....)))))..(((.(((((....(((((.((((....((((((.(((((....))))).))))))..))))......(((..(.(((((...((.(((((((((...)))))))))))....))))).)....))).......(((((((((((.(.(((((((((((....((((((((.((....)).))))))))....(((.....)))(((((..(((((((........))))))))))))...))))))))))).).)).))))))))).)))))))))))))....))))))))))..))).)))).......(((((((.((.....))...)))))))..))))))))))..)))))))..(((.((.....))..)))(((.((..((((((((((......))))))))))..)).))).....))))))))).)).)))))))))....(((((((.....)).))))).....((((((((((((((.(((.(((((...))))).)))))))))..))))))))))))..)).))))).)))))))).)))...........
Thermodynamic Ensemble Prediction
,,,{,{{{{,,..,{{{{((((.(((((..((.(((((((..((((.((,({(((..((((((,(((((((..........)))).)))....,((((((.(((..(((((((((......((...{((((((((((............((((...((.((.((((((({...}))))))))))))))))))))))).,,}}}.))..,.)))))))))..)))))))))}.})))))..))).)).)).)))).))))))).))...)))))..}}}|,.(((((((((.(((((((({((((((,{((((((,{,,,,{|||||||.,,}|||||||||||{{||||{{{((||,...{{{,,(({(,.{((((|...))))))}}}},||||||,,,,{(((({...,,,||,.|(((({(({{({((((........)))).....,.....,...(((.((.(((((...})))).)).)))..|.|,,.,,|||||{.{{{,..||||.,|{{.((((((......(({{...,))))......)))))).)}||||.|||.,.|||}...,}}}}|}|,..||,,{|,,,},..}},..(((((((((((.((((.........,((.{((((((((..(((((...........))))).))))))))),)}...{(((((((((......))))).,,.})))}.{{...((((((({..(((((.....)))))...),)))))))..}}))))..))))))))))).}|}}.,)}}))......((((((.((((.(((((((,(((.{{{((,,((.((.(({(((((....,,,))}))})).)).))))){(.((((.((((((((({(((((....))))).(((((((((.(((.......)||,)))).))))),..,,,..,{(((((.((((((((((..(((((((.....)))))))..))))))))))}))}||{.(((({(((,,{{,{{.{,(({((({,..|}|}|||||||||.{,{{(((((.(((((({.|||,{|.,{{{...(((((((...{((((({{((({...})))))))).)}...)))))))...))).}}}}.,})))))))))))}},{{{((|,{{,||..}||}}||}}||||}|}..||}}},.,..))))))}})))))),}))}})))))}))).,)))))))))).)))))}.)))...))))))).)))).))))))...,,,({.,|||{|..((({.....)))).})))}}.}))))).(((((((((((((((((((.(.(..(((.{(((..(((((((.((((({{((...(((......)))..)))))))).))))}..,))..)))}.)))..).).))))))))))))..........{{.....}}..))))))(((.((({(((((...........)))))))).)))}})))))),}},}}})})).}})))),.)))))))))}})))))||{({{({((((({((((((((((((......(((((...)))))|||))))))},,,..(((((|.{(|{|,..||((((,({.(((({((((((((,,{.{{,,{{,{,|,,,,....))))}((((((((((...))))))))))..((((.(((..((((((((((....{{,,(({(....,)))}|((,.....}},...........{(((((((((((((.....,,{(((....{{{{|||,(((((.(((.......)))..)))))...,|||||||||},....,((|((({(((({,,.{(,,,..}}..,)))}},|}}}}}})),,||,|,}}.|}}}}}}..})))))))),....})))}..(((.(((((....(((((.((((....((((((.(((((....))))).))))))..))))......,{{,,,.(((((...{{.(((((((((...)))))))))}}....))))).}....})}.......(((((((((((,(.(((((((((((,,,,,|,{{(({{{|....))))}}|,|||,...{{,.,,,,))){(((({.|{(((((......,,)))))})))))}...))))))))))).).)),))))))))).))))))))))))),...))))))))))..))).)))),......{((((((.{{.....,,...))))))).........}))))),,))))....))))..({{{,..))))))))))}|{((((((({....,.))))))))))))))})}))}})))))}}))))},}}}))}))})),|||{{{{,||,....||{|,||{(({.((((((((((((({{{(((.(((((...))))).)))))))))..))))))))).)))))).)))),,},)))))),},},,..,,,,...

Transcripts

ID Sequence Length GC content
GGAUGCUUAUUAUAGAUCGACGCGACACCAGCGCCCGGUGCCAGGUUCU… 2477 nt 0.5943
Summary

This gene encodes a basic helix-loop-helix transcription factor which is expressed in oligodendroglial tumors of the brain. The protein is an essential regulator of ventral neuroectodermal progenitor cell fate. The gene is involved in a chromosomal translocation t(14;21)(q11.2;q22) associated with T-cell acute lymphoblastic leukemia. Its chromosomal location is within a region of chromosome 21 which has been suggested to play a role in learning deficits associated with Down syndrome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal cell composition and gene expression, specifically increasing oligodendrocyte proportions by 12.4% and causing differential expression in endothelial, microglial, pericyte, and astrocyte clusters [Bakulski et al. DOI:10.1093/toxsci/kfaa069].