Basic Information

Symbol
OMP
RNA class
mRNA
Alias
Olfactory Marker Protein Olfactory Neuronal-Specific Protein
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Postmortem interval inference

MANE select

Transcript ID
NM_006189.1
Sequence length
492.0 nt
GC content
0.6301

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-200.70 kcal/mol
Thermodynamic ensemble
Free energy: -209.60 kcal/mol
Frequency: 0.0000
Diversity: 94.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((((.((((((((.((((((((((((((.((.(((.((((((...))))))))).)).))).))...)))))))..)))))....))))).....((((.((((((.(.((..((.(((((...(((((((((.((..(.(((((.((.(......).))))))).)...)).))))))))).....((.((((((((..(((((((..((.......(((..((((..(((......((.....)).....)))..))))..)))......)).)))))))..))))).))).)))))))))))).)))))).))))..(..((.((((....(((.....)))..)))).))..)..(((.(((.((((((.((((((..((((.((.....)).))))..))))..(.(((.(((((((((....))))))))).))).))))).)))).))).))))))))))((((...))))........
Thermodynamic Ensemble Prediction
...(((((((.((((((((.({((((((((((((.((.(((.((((((...))))))))).)).)))}})...)))))))..)))}}..,.})))).....((((.((((((.(.((,(({.(((((.,.(((((((((.((..(.(((((.{(.(....,,,.}}))))).}...)).))))))))).,...((.((((((((..(((((((..((.......|((..(((({,.,....,{(((..,..,,.....}))..)))))))))..)}..)).)))))))..))))).))).)))))))))))).)))))).))))..(..((.((((....(((.....)))..)))).))..).,(((.(((.{(((|(.(({(({|.{{((,((.,,..}}.}}})).)))),.{.{((.(((((((((....))))))))).))).}))}).)))}.))).}))))))))|((({...}))),.......

Transcripts

ID Sequence Length GC content
AUGGCGGAGGACAGGCCGCAGCAGCCGCAGCUGGACAUGCCGCUGGUCC… 492 nt 0.6301
Summary

Olfactory marker protein is uniquely associated with the mature olfactory receptor neurons in many vertebrate species from fish to man. The OMP gene structure and protein sequence are highly conserved between mouse, rat and human. Results of the mouse knockout studies show that OMP-null mice are compromised in their ability to respond to odor stimuli, and that OMP represents a novel modulatory component of the odor detection/signal transduction cascade. [provided by RefSeq, Jul 2008]

Forensic Context

A study in the forensically important blow fly Aldrichina grahami identified 27 odorant binding proteins (OBPs), one chemosensory protein (CSP), 49 odorant receptors (ORs), six ionotropic receptors (IRs), and two sensory neuron membrane proteins (SNMPs) in its antennae, with 740 genes differentially expressed between sexes and phylogenetic analysis suggesting roles in detecting decomposition volatiles [Han et al. DOI:10.7717/peerj.9581]. Research in Chrysomya megacephala identified 49 OBPs, 12 CSPs, and 11 IRs in a developmental transcriptome, with qPCR validation confirming specific OBPs like Cmeg32081_c4 were highly expressed in adult female heads and antennae while others like Cmeg33593_c0 were upregulated with larval age [Wang et al. DOI:10.1186/s12864-014-1200-y].