Basic Information

Symbol
OPRD1
RNA class
mRNA
Alias
Opioid Receptor Delta 1 Delta-Type Opioid Receptor D-OR-1 DOR-1 OPRD Opioid Receptor, Delta 1 Delta Opioid Receptor 1 DOR1 DOP DOR
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_000911.4
Sequence length
9317.0 nt
GC content
0.5464

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-4122.30 kcal/mol
Thermodynamic ensemble
Free energy: -4269.00 kcal/mol
Frequency: 0.0000
Diversity: 2392.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((.((((......)))).))..((((((((((((((((((((((((.(((((((((.((.(((((..(((((((....((.(((((((..((.(.(((.((((.((((((((.(..(((((((.(..(((((((..((((((((.(.((((((...((((((((((...)))))..)).)))....))))))).)))).)))).)))))....))..))))))))).)))))))))))).))).).)))))))))..)).....)))))))..))))).))...(((((.((......)).)))))....((.((((((((((((((.(((.((.(((...))).)).)))))))))...(((.......)))........(((((((.((((.((((((((((((((...((((((.((((((((((.((.(((((((......((((((.(((.(........).))).)))))).....(((((...((....))...)))))...((((.(((......))).))))..((((..((((((((((((((((.....(((((...))).))..))))))).)))))))))..))))....(((((.(((((((....(((((((.(((((((((.(((..(((.((......)).)))...)))(((....)))....((....))(((((((((((.((((((.((((((((.....)).)))..)))..))))))..))))..))))))).)))))))))...))).))))(((((((...)))))))))..))))).))))).((((((...(((((....))))).))))))..((((((((.(((((.((.(((..((((..(((((.((.(((((((((..((((((.((((((((((...(((.....)))((((((....))))))(((((((.((((.(((..(((........))))))))))....)))))))...)))))))))).))))))..)))))))))..)).)).)))..))).)..))).)).))))).))))))))))))))).)).))))))).))).))))))....((((((((.(((.(((((((.((.((((...)))).))))...((...(((.((((........).)))))).))....(((...))).......))))).))).))))))))...((((((.....)))))).........))))))))))))).).)))).))))..)))..))))).)))))(((((((((((.(.(((.........))).).))))))))))))))))))))))).)))...))))))))).....((((((((...(((...((((((((.((.(((...(((.((...((.(((((((((..((((((((((.((((.(((((((((((((((((..(((((......)))(((((...)))))..))..))))))).((((((((((...(((.((((.((((((..(((((.(((.(((((((((......((((((((..(((((((((((..((((((.((.........))))))))((((((((((((((.((((((...((((((((((..(((((((.(((.(((.(((((.....)))))..((((((((((.(((((((((........)).))))))).)))))....)))))(((((((((((....)))))))))))((((((.((...(..(((.(((.(((((((..((((((((((..((.(((...(((((((((((((((.((...)).))))(((((((((((..(((....)))....))))).(((((((((...))).))))))(((((..((((((......((((.(((......)))))))))))))..))))).......(((((...))))).(((((..((....))..))))).))))))...(((((.(((((...)))))..)))))........(((...((((((..((..((((.(((.((((((((((.(((((((((((((((((((((((((((.(((((.(((((((...(.((((..((((((((((((((((((.(((.(((.(((((((((((((((.((((.(((((((.(((((((((..((.(((((((((((((((((....(((((((.(((((((((((.((((((.((((((.((((((((...((.(.(((((((((((..(((((((((((((((((((((((((.(.(((((((..((((((((((((..((((((((((..(..((((((.(((((((((((((((((((((((((((((((((((.(((((((((..((.((((((((((((.(((..((((((.(((((....(((((........(((((..(..(((((((((((((((((((.(((((.((((((((((((.(((......))).......((((((((((((((((((..(((((((((..............))))))))).(((((((..........))))))).....(((.((((............)))).)))..))))).)))))))((((((((((((((((((((((..((.(((((.(((((((((((((((((((((((((((...(.((((((((....(((.((..((((((((((.....((((((.(((((...)))).)..))))))((((.((((.........)))).))))...(.((((((.(..((((((....)))))).).)))))).)..(((((((((....)).)))))))))))))))))..)).)))((((..((((.((.....)).)))))))).(((.....)))..)))))))).)..((((.(((...))).))))...)))))))...(((....)))))))))))))))))......((((((((((((..((((....)))).((((((.(((((((.((((((..((((((...(((((.((((.(((((((((...((...(((.(((....((((..........(((((((.((((......(((((.(((..(((...(((((.....)))))(((((((((((((....(((((((....)))))))...)))).....))..))))))).(((((.((((((((((..(((((((((((((.((...((((((.....(((...((((((.(((((....(((((((.((((((.................)))))).)))))))((((.(((((((((..............(((((((..((.(((((((((((((..((....))..))))..))))))))).)))))))))....(((((((.........))))))).....((((((((.(.(((((......))))..).).)))))))).....))))))).))..)))).....)))))..))))))...))).....))))))...)))))))....))))).)))........)))))))))).).))))..)))..))).)))))..)))).))))))).((((((((((((.((.((((((....)))...))))))))))))).))))...((((((((((........)).)))))))))))))))...)))...)).)))))))))......((((.((.(((.((.(((.(((((((..(((.((((......)))))))..)))))))))))).)))))..))))((((((....))))))..(((.(((....))).)))..)))).)))))...))))))....)))))).(((((...))))).....((((....))))...))))))).))).))).)))).))))))))))))))))))).)).)))))((((.....)))).((((((....)))))))))))))))))))))))))))))(((((...))))).)))))))).....)))))))))...)))...))))))))((((...((((((((.((((.((.....)).((((((..((.((((((..((((...((((......))))...))))..))))))))))))))...(((((.....))))).)))).))))))))))))......((((.(((..((((((...........)))))).......((((.(((......))))))))))..)))))))))))).....)..))))))))))..))))).))))))..........))).)))))))))))).))....)))))))))((((.((((.(((((((((((...(((((...((((((((((.((....(.(.(......).).)..)).)))(((((((((.......((((((((.((((((....))))))((((..(((((.(((.......))).))))).)))).))))))))((((.(((((((((((((.(.(.(((((.....))))))).))))))).)))))))))).........)))))))))((((((....(((((((..((..(((..(((((.(((.....))).(((..((((.(((((((.....(.(((..((((.((((.((((((....)))))))))).))))))).)......))))).)).))))..))).(((((((((....((((....))))..)))))))))...)))))........((((((((.......(....)......))))))))((((....)))))))))..)))))))....)))))).((((.((((((((((......)))))))))).))))((......)).....)))))))...))))).))))))))))......(((((.....))))).......(((((((((......((((((((....))))))))))))))))).).))))..)))).........)))))))))...)))).))))))).))).)))))))))))).))))))..)..(((((..((((((((((((((...(((((...(.((((((((.((.......)))))))))).).....)))))((((...(((....))))))).(((((....)))))...))))).))))))).))..)))))...(((((((((...........................))).))))))))))))))))..))))))))))))..))))))).).)))))))))))))))))))))))))..))))))))))).).))...)))))))).)))))).)))))).))))).....))).))).)))))))....)))))))))))))))))..))..)))))).))).))))))).)))).))))))))))).))))))).))).))))))))))))))))))..)))))...))))))).))))).))))))))))))))))))))))))))).)))))))))).))).))))..))))))))...))).((((((((......))))))))...)))).....)))))))...))).))..)))))))))).)))))))))).)))..)...)).))))))...))).)))))))))).)).))).)))))..........((((((.((.((....)).)))))))))))))).)))....))))))))))).((((((((((..((((((((((...((((((..(((((((.(((((....))))))))).......(((((...(((......)))...))))))))..)))))).....)))((((((((......)))))))).)).)))))..))))))))))))))).))))))((((((........))))))..))))).((((((...(((((.((((((((((((.((((....))))(((..((((((.(((((((((.((((((((((((.((....(((((....(((((((......(((......((.(((........((((((((((....((((....((((((.(((((..(((((..((((((((......(((((((.(((((((((.((((.(((((((((((((((((((((((.......)))))))...........((((((((((.((..(((.....(((.(((........)))))).....)))..))))))))))))(((.....)))....))))))))))..))))..)).)))))))...((((((.((.((....(((((............)))))....)).)))))))).......(((((...(((((....))))).....)))))...))))))))).)))).)))))))).)))))..).)))).)))))).....))))...)))))).)))).....)))))....)))(((((((((.(((((((((......))))))...............)))))))))))).))))))))))))..)).))))).))))))).)))).................(((((((((((.((((((((.((((((((((((((((((((((((((((.(((.(((((((((((((((((((((((((...(((((((((.((((((((((((((((((((((.(((((((((.((((((.((((((.(((......((((((..((((((((((((((((((((.((((((((((((((((((.((.(((((((.((..((.((((((.(((((((((.(((((((((((.((((((.(((((((((.(((((((.((((((((((((.(((((((((((((.....(((((((...(((.......)))((((((((.(((((.((((((((((.((.((.......((((...(((((.(((....))).))))))))).......)))).)))))).....(((((((..((.........))..))).))))..((((((((.(((..............)))))))..))))..((..((((.......))))..))(((((((...(((..(((((((..(((((...(((..((((.(((((((.(((((((((.............(((((((((.........)))).)))))...........(((((((...)))))))))))).)))).))....))))).))))..)))...((((.(((((.((.....)).))))).))))...)))))..).))))))(((((((....)))))))....))).....)))))))....)))))))))...))))))))((((((...((..((.((((....((((((((.(((((((((.((..(((.......))).))))).))(((((((((..(((.(((((((((((((((...))))))))))........))))))))..(((..((((((((....)))))))).)))((((..((((((....(((.((((((((((.((((.((((((((............)))))))).((((((((...)))))))).......(((((((((...((((((((.((((((((..((((.(((..(..((((...((((.....((((((........))))))...))))))))..(((.(((((((((((..........))))))))).))...)))......((((((((....).)))))))((((...((...((((((((((((.(((((.....))))).)).)))))...........((((((((...(((....))).))))).)))....((((((......))))))...........((..((...(((((.......)))))...))..))...((......)).)))))...)).)))).)..))).))))..)))))))).)))))))).)))))))))..((((((((((....))))(((.....)))..)))))))))).)))))))..))).)))))))))))))...((((...........))))......((((((...(......)....)))))).((((((....))))))..............)))))))))((((.....))))..........))))...............((((....)))))))))))))))).))))...))))))............))))))).....))))))))))))).)))))))))))).))))))).))))))))).)))))).))))))))))).))))))))).)))))).))..)).))))))).)).)))))))))))))))))).))))))))))))))))))))))))))))).)))))))))))).))))))))).)))))))))))))))))))))).)))))))))...)))))))))))))))..)))))))))).))).)))))))))))))))))))))))))))).)))))))).)))))))))))((((...)))).........))))).)))))).))).....))))))))))))..))))).((((.........))))(((((.((.((((.((((((.....))))....)).)))).)).)))))))))))...)))....))))))))))))))))).))))))...)))).)))((((((((....))..(((((..(((....)))......)))))...((((((.(.....).)))))).)))))).(((....)))((((......))))((((...))))))))))))))...((((((.......))))))(((((....))))))))).))))))))))))))))))))..).))))).))).))...)).)))...)))..)))))))))))))...))))))))..(((..((.(((((.(((((((((((((...)))....((((((((........)))).))))((((...)))).(((((....))))).......(((.((((((....))))))))))))))..((((..((((((((((((((........(((((((.....)))))))....))))))......((((.((((((...)))))).)))).((((.....)))).))))))))....))))(((((...)))))...)))))((......)).......))))).))..)))))))))))).
Thermodynamic Ensemble Prediction
.,.((,(((({{{{.{||,|{||{{((({{{,({((((((((((((((({((((((((({((.(((((..(((((((..(,({.(((((({.{((.(.(((.((((.((((((((.{..(((((((.{.{(,(((((..((((((((.{.((((((...((((((((((...)))))..)).)))....))))))).)))),,))).)))))....))..})))))))}.)))))))))))).))).).))))))))).})}.,...)))))))..))))).,)|,.(((({,{|,...||}|||||{{,,..|||||||{||{({{(((,(({.{{.{{|,,,))),)).)))))))))....|||....,,|{(({{..,..(((((((.((||,((((((((((((((,..((((((.({{{{{{(((,({.{((({((|.....((((((.(((.(........).))).)))))).....{|||{...{|,,,.}}},})))}}...((((.(((......))).))))..((((..((((((((((({((((,{{.{({({{...)}).)}}}))))})).)))))))))..)))).....((((,(((((((.{,,((((((({({{{{,{{||||||,(((.((..,,,,||,|||,|,{||((({...}||{,.,((.,..||(((((((((((.((((((.(((((({,.,...,).}}}..))),.))))))..))))..))))))).}}}|}|}}}...})),}))}(((((((...)))))))))}}))))).))}}|.((((((...(((((....))))).)))))}..((((((((.(((((.((.(((..((((..(((({.((.(((((((((..((((((.((((((((((.{(((({.{{.(((((,({(,,,{||||||{|||{{{,||{{,|||,|(({...,....)))),))))).}).))),)))...)))))))))).))))))..)))))))))..)).)).)})..))).)..))).)).))))).))))))))|})))}),)),))))))).})),)))))}....((((((((.(((.(((((((,{,.{|||...|}|},||||,..{{...,{|,||||........)}))|||.,|},,,,.,,...)))}......))))).))).)))))))).,.((((((.....)))))).,.,,,},.)))))))))},,.,}.}}})}))))..)))}}))))},}))))|||||{|||||,|,{{{,,,,,.,.,|||,|.|||||||}}}},))))))}}})).||||.,|}))))}}}.}.,||||||||||}.,||.|}||}}}|(({({{,,.{{{(...)))}(((....))).,.}}||}|{{,|{{|{,,{{((((((,,(((((((((.{(({,,{{{{({(((({{.((((((....)))))).))|||.},|,,|}))).|(((({(((({((((,({{({{{||||{||||||.((({(({..((({...|)))..})))))).{{((((({{((..{.{{{{,|,||||||((((((((((((((.((((((.({((((((((,{,.(((((((.(((.(((.(((((.....)))))..((((((((((.(((((((((,....,,,}}.))))))).)))))....)))))(((((((((({....}))))))))))((((((.{(...{..(((.(((.((((((({.{(((((((((..((.(((...(((((((((((((((.(,...}).))))({(((((((((..(((....)))....)))))}(((((({({...}}}.)))))),{{((,,(({{{|,,,,,.((((.{{{,,,,,.}|||||||}||||,,|}|}}.......(((((...))))).(((((..((....))..))))).,}}}}}..,|||||,|||||,,.,}))).,))}}}........(((...((((((..((..((((.(((.((((((((((.(((((((((((((((((((((((((((.(((((.(((((((...{.((((..((((((((((((((((((.(((.(((.(((((((((((((((.((((.(((((((.(((((((((..((.(((((((((({((((((.,..(((((((.(((((,((((({({(((((((((((.(((((((((((((.(((((((((((((((((..(((((((((((((((((.(((((.(((((((((((((.(((,((({.((((((((((({((((((,,({(((((((((((((((,{((({{{{{,(((((((((,(((((((((..((.((((((((((((.{{,..{(((((.(((((....(((((........((((({.(..(((((((({((((((((((.(((((.(((((((((((({{((.,....|||,......((((({((((((({((((..(((((((((..............))))))))).{{(({((.,,,,,....}}})))),....(((.((((............)))).)))..))))}.)))))))((((((((((((((((((((((..((.({(((.(((((((((((((((((((({{({(((((,{(({{{{((({(((,{,{(({{((((((((((,....((((((.(((((...)))).}..)))))}((((,((((,........}}}).)))),,}}))},)))))}}))),.}}))}),||||.{.{{{.{{....(((((((({....}}}})))))),,))))),)}}})).,,.,||,..{(((.{{..,,,)).))))}}},,{{{.,,,.|||,.||,{|||.{|..((((.(((...))).))))...}))))).,}}}))),.}))))))))))))))))),.....((((((((((((..((((....)))).((((((.(((((((.((((((..((((((...{(((({((((.(((((((((...({...(((.{{(,...((((..........(((((((.((((......(((((.(((..(((.{.{((((.....)))}}{{{((({{,((((....(((((((....)))))))...))))..,,,}}...,}}}}|.((((,{((((((((((..(((((((((((((,{(.,,((((({.....(((...((((((.(((((..,,(((((((.((((((..,,,....,}......)))))).)))))))((((.(((((((((..............{((((((..{{.(((((((((((((..((....))..)))),.,)))))))).}}))))))},,(,(((((((.........))))))).....{(((((((.{.{((((......})}),.,,}.)))))))}.....))))))).))..)))).,,..)))))..))))))...)))....,))))))...}))))))....)))))},))........)))))))))),).)))),.)))..))).))))).,)))).))))))).((((((((((((.{{.((((((....)))...)))}}))))))))}})))...((((((((((........)).)))))))))))),})}..)))...}).)))))))))......{{{{.,,.(((.((.(((.(((((((..((,{((((......)))))))..)))))))))))).)))||,,|}||((((({....}||}}|..,{|||||..,})))})}}.,))),,)))))...))))))....)))))).{((((...))))}.....((((....))))...))))))).))).))).)))).)))))))))))))))))}).)).)))))((((...,,|||}.,{{{||,,,.))))},))))))))))))))))))))))){{(((...))))).}))))))}.....)))))))))...)))...)))))))|((((...((((((((.((((.((.....}}.(((({{..{{.((((((..(((({,.((((......)))),}.))))..))))))))}))))},..(((((,...,))))).)))).))))))))))))},....((((.{((..{{{{||,.,......{{||,,,,}}}}.,,((({,(((......))))))))))..)))))))))))).....})}))))))))))..))))).)))))}..,,......}}}.)))))))))))).))....)))))))))|{{{,((((..((((((((((...(((((.,.((((((({{(.((....,.{,{.....,|.|.|,,,,.,)){((((((((.......((((((((.((((({....})))))((((..(((((.(((.......))).))))).)))).))))))))((((.(((((((((((((.(.(.(((((.....))))))).))))))},)))))))))).........))))))))}((((((....(((((((,(((..(({((((((((((..,.(((((((((..((((.({(((((....,(.(((..((((.((((.((((((....)))))))))).))))))).),,....))))).}).))))..))).(((((((((....((((....))))..))))))))).....,,.....{{...{(({....}}},..}}....)))))).}..)).))},))))).)))}})}}..)))))))....)))))).((((.((((((((((......)))))))))).))))||,.....}...,,.)))))))...))))).))))))))))......(((((.....))))).......(((((((((......((((((((....))))))))))))))))).).))))..}}}}......,,.)))))))))..}))))))))))))})),.)))))))))))))))))),}}.))).))))))))))))).))))).)))))}},....|}}})))))))..))))))))))))))))).))))))))))))).)))))))))))|{{|{.(((((....)))))....)))),.|.((((.(.(((((,|...(((((({{{................|...,......})),,)))))...........{{.(((((((.....))))))).)}.((((.(((((((((((({.{,.....))),)))))))..)))))))).})))))....))))).).))))})))},)})})}))).)))))))..,.))))))}))))))))))..))..)))))).))).))))))).)))).))))))))))).))))))).))).))))))))))))))))))..)))),...))))))).))))).))))))))))))))))))))))))))).)))))))))).))).))))..)),}))))},.))).((((((((......))))))))...))))}....}))))))...))).))..)))))))))),)))))))))).)))..,...),.))))))...))).)))))))))).),.))).)))))}.........((((((.((.((....)).)))))))))))))).)))....))))))))))).|(((({((({{,((,{((({,,,,.(((((({{{{{{(({{(((((....))))))))}.......(((((...(((......)))...))))},}}..}||||,.,,....|((((((((,..,,,|||||}}|..|||}}}|||||||||}}||,|||||||||,,((((((........))))))||}},}}}||{||{.{|(({|{.|||(({{{,{|{,(({{..{,|||||{{.|{{,|{{,({{(((((({((({{{{{||{{,({.,,|,{{||,....|||}}}}}.}}}|||}|.|}|,{{({({{,,....{{||{||||(,,,,((((,,..((((((,({((({.(((({.,((({((((......{{{{{{(.(((((,,{{{((((,{{((((((((((((({(((((((.......)))))))......,,,..{((((((({((((..(((.....(({,{((,,....}})}}))).....)))..)))))))))))){{{..,,.,))}...))))))))))..,)))},)),))))))).||||||{|||,|{{,..,|||}}).}}})}....}.)))}),)))))){{{{.....)))}.|||||,,,|||||...,))))),,,.,)}})),,,))}}}}}}}.}))}.)))))))}.))}}}..},)))}.}|||||,....}))),,,}}||||,.||}...|||||}},..,|||{{{||||{{.{{{{(((((......)))))},,|,,,,.,....,.)))}))))))}},))))}))))}))}.}}|||||.,}}||||||||},..{{,..,(,((({{..(((((((((((.((((((((.((((((((((((((((((((((((((((.(((.(((((((((((((((((((((((((.,.(((((((((.((((((((((((((((((((((.(((((((((.(((((((((((((.(((......((((({.,((((((((((((((((((((.((((((((((((((((((.((.(((((((.((..((.((((((.(((((((((.(((((((((((.((((((.(((((((((.(((((((.((((((((((((.{((((((((((({.....{(((({,..,(((,.....,|||{(((((((.{(,{,.,{{{,,,,(((((((......},.,|}))){{{{{,||{..,,)}),))))}}}.}}},..,.((((((((((((..{,{((({{{..{{.,,,,....||,|}||.}}}}..((((((({{(((..............)))))))..))))..{{..{{{(,{,....}))),.},{{(({{{,.,|,,..(((((((..(((((...(((..((((.(((((((,(((((((((.............(((((((((.........)))).)))))....,,,,....{{{{||,,.}})))}}))))).)))).))....))))).))))..)))...((((.(((((.((,...,)).))))).))))...)))))..).)))))}(((((((....)))))))},..,}}....,))))))}))))))).))))).},))))||||(((((({,,(({((({(((....,{||||,{|,|||}|,{{{|||,,{((,,,..,,|||.|}}},..,,|||||||||,|||.{{{{{((((((((({...)))))))))).....,..})))})))}.(((..((((((((....)))))))).))),,{|{{{(((((....((({((..(((,,,.,,,,..||||||}}}.,,.}}...|||}}}}))}(((((((|...})))))))..,,,,,(((((((((...((((((((.((((((((..((((.(((..{.,{(,{..{(((({{(..((((((........)))))}.,.|||,,|{|,,{,,.(((((((((((..........))))))))).}|..,||||.....((((((((....).))))))).....,,||},,{|{|{(((((((.(((((.....))))).))},)))}...........{{((((((...(((....))).))))).}},....{{||||......}||}||.....,,,...,,..{{...(((((.......)))))...})..}},..{{......)).)})))},,)))),}},)..))).))))..)))))))).)))))))).)))))))))..,{||||||||,},,,},{(((.....)))).,}||||}},|{|||||,..{{{{{{{{||,|||.||,..{(((.{{{{.....,,||||......(((({(,,,.......,....)))))).((((((....)))))).,},}}.,.}}}}.)))),||||(((..{{{.|,||{...,,,,,,|}|}...............,,,,,}},))))))),))),))))}))}).)))))))))))},..}}}))))})))),},..))))))))))))).)))))))))))).))))))).))))))))).)))))).))))))))))).))))))))).)))))).))..)).))))))).)).)))))))))))))))))).))))))))))))))))))))))))))))).)))))))))))).))))))))).)))))))))))))))))))))).))))))))).,.)))))))))))))))..)))))))))).))).)))))))))))))))))))))))))))).)))))))).))))))))))).{(({,,||||,,,,,.{{{||{{||||,,..(((((({....))))))).....)))))}.,,,...,{{{|{.|,|{(,.....}}}.|.||}}}}.)))}}.,}},,)))}))}||||{||||}}}}}},..||||||{{|||||,,|||||||{{|..{{|||..{{{||{{{({(((.(((,.{{{,.{((((({{(((....))).{{{.{{{|||{{{{|{{,.((((((.((((({...))))))))))))}|)))({((......}}}}..,,,..))))))}}.}}}....,((((((.......))))))|((((....))))}..{{{....)))|{((((({.{(({....)))).),,)))))}....)))))))))))))))|)})))}}...})),)))))}}}}}..}}}||||,,,|}||}||{|}},||{,{{....{{((((((........)))).))))||||},.}))).(((((....))))).......(((.((((((....))))))))),,}}}},,,},.,|||||||||{{{{,...,}}},|{|||||.....)))))}),}}.)})))),,....,{{(,((((((,,,|||}}},)))).||||,,,,,))))})))))))))))))))}|||,|}}})),))).}))))))),,.,|||,.....,})})))))}}})})))))}}})}.

Transcripts

ID Sequence Length GC content
ACAGCGCUCCGGGCGAGGAGAGCGGGCGGACGCCGGGGGCUGGGCCGGU… 9317 nt 0.5464
Summary

Enables G protein-coupled enkephalin receptor activity. Involved in several processes, including G protein-coupled opioid receptor signaling pathway; cellular response to hypoxia; and positive regulation of peptidyl-serine phosphorylation. Located in plasma membrane. Implicated in alcohol dependence; alcohol use disorder; drug dependence (multiple); opioid abuse; and withdrawal disorder. Biomarker of opioid abuse. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in rats demonstrated that the OPRD1 mRNA expression was significantly increased in the hypothalamus of a fatal hypothermia group compared to controls, suggesting its involvement in thermoregulation at low ambient temperatures [Umehara et al. DOI:10.1016/J.Legalmed.2011.01.005]. In a separate study using a mouse model, the OPRD1 mRNA expression in the brainstem showed no significant differences among groups exposed to carbon dioxide intoxication, combined high CO2/hypoxia, hypoxia, or controls, indicating it was not a significant marker for differentiating these causes of death [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].