| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCUCUUCUUGGACUUUUAAAUUGUGGCUACCUAAAUUGAGUAUCUG… | 1039 nt | 0.4312 | |
| CUUUCUCUUCUUGGACUUUUAAAUUGUGGCUACCUAAAUUGAGUAUCUG… | 983 nt | 0.4232 |
This gene encodes a member of the proline-rich protein family. The encoded protein has multiple proposed functions, including roles in pain suppression, penile erection, and protection of the eye surface. The QRFSR pentapeptide, known as opiorphin, is derived from the N-terminal of this protein. Opiorphin inhibits the enkephalin-inactivating peptidases neprilysin and aminopeptidase N, and this activity is thought to reduce sensitivity to painful stimuli by effecting enkephalin-related activation of opioid-dependent pathways. Opiorphin may also act as an anti-depressant. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
A study in humans identified the OPRPN as a candidate mRNA marker for nasal mucosa detection via RNA sequencing [Chirnside et al. DOI:10.1016/j.fsigen.2020.102317]. Initial testing showed the marker could amplify in nasal samples, though it exhibited potential for dropout and was undetected in samples from donors with allergies or unknown causes, while being detected in samples from illness or after eating spicy food. Specificity testing at a 0.01 μM primer concentration revealed no cross-reactions in non-nasal body fluids, and the primer set did not amplify genomic DNA, leading to its proposal as a final candidate marker for forensic assays to identify nasal mucosa and interpret potential false positives.