| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUGAAUUCCCUGAAGGACGGGAAUCACACCGCUCUGACGGGGUUCAUCC… | 969 nt | 0.4396 |
Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. [provided by RefSeq, Jul 2008]
A study in the blowfly *Calliphora stygia* identified 50 candidate odorant receptors (ORs) via antennal transcriptome sequencing, including the conserved co-receptor Orco and putative orthologues to pheromone-specific receptors like DmelOR67d, with quantitative differences in transcript abundance observed between sexes [Leitch et al. DOI:10.1186/s12864-015-1466-8].