Basic Information

Symbol
OR6A2
RNA class
mRNA
Alias
Olfactory Receptor Family 6 Subfamily A Member 2 OR11-55 OR6A2P OR6A1 Olfactory Receptor OR11-83 Olfactory Receptor 11-55 Olfactory Receptor 6A2 HP2 Olfactory Receptor Olfactory Receptor 6A1 Olfactory Receptor, Family 6, Subfamily A, Member 2 Pseudogene Olfactory Receptor, Family 6, Subfamily A, Member 2 Olfactory Receptor, Family 6, Subfamily A, Member 1 Seven Transmembrane Helix Receptor HI7 Olfactory Receptor I7
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_003696.3
Sequence length
4295.0 nt
GC content
0.3844

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1131.00 kcal/mol
Thermodynamic ensemble
Free energy: -1206.63 kcal/mol
Frequency: 0.0000
Diversity: 1206.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......(((((((..(((((((.....(((((((.((((((((.((((..((((.......(((((((((((((........(((((.(((..(((((((((((((((((((((((....((((((((((......)))).....))))))))).(((...((.((((((((((((((.((((...((((....))))..((((((......((((.....)))).....((((............))))))))))..)))).)))).))))....)))))).))...))))))))).(((((((..(((((((..((.(((.(((((((.((..((((((((((((((.(((((.((((.(((((((((((......))))..((((((.(((((((......((..((......)).))..)))..)))).))))))(((.((((......)))))))....))))).)).)))))))))(((((((((.(((..(((((.((.......))...)))))...))).)))))....)))).....((((......(((...((.(((....))).))...))).....))))(((((((((((((...........(((((((((((..((((((((..((........))...))))))...)).)))))))))))..))))).((((((((((.....)))).)))))).(((((...((((((...(((((.....(((((((((((.((((....)))).)))))))))))..))))).))))))...)))))...)))))))).(((.....))).........))))))))))))))..))...........)))))))...))).))))))))).)))))))........(((((((((((((((...((((.((((....(((.((.((((((((...............(((((...(((((((.(((.(((.(((...((((((.......((((......))))........)))))).))).)))....((((((.(((((((((.((((((.((((.((.(((.(((.............((((((((........))))).)))(((((((.......))))))).....((((.(((((((((.((...((((..(((((...(((((((.((...((....(((((.((((..((....((..(.(((((.(.((..(((.((((((((.........))).)))))..))).)))))))).)..))..))..)))))))))....)))).)))).))).....)))))..))))......))..))))))))).))))(((.(((.(((...))).))).)))(((((.......)))))..(((((((.((......)).)))))))(((((....)))))......)))))).)))))))))))).)))))).....((.(((((.....))))))).))).))))))........))))))))))...)))))(((.((((((((...............)))))))))))..........(((((....))))).(((..(((((((.......).))))))..)))..(((((((...)))).))))).)))))))).))).....))).).))))....)))..(((((((((...(((((((((..((((((((..............))))))))....))))))))).)))))))))......((((((.((((...((((.........)))))))).))))))((((((....(((.((((((.....)).)))).)))..((.(((((((((.(((((..((.......))..)))))....))))))))))).))))))))))).))))))))))))))...((..(((((.........)))))..))....(((((((((((.((((....)))).)))))))))).)))))))).))).).))))((((((..........)))))).))))))))))))).......((((........))))..........(((..(((((..................))))).))).))))..)))).))))))))..)))))))....))))))).........((((((((....(((((......((((.....))))...))))).....(((....)))...........((((((......)))))).((((.(((.(((.......((((.(((((.((.((((((((..((.((..(((((.....)))))(((.(((((....))))).)))......((((((......((((((((((((((.(((((....)))))......((........)).))))).))))).))))))))))((.(((((((....))))...))).)).(((((........))))))).))..)))))))).))))))).))))......((((((((((((..((.(((((((((........))))))))).)).)))))).))))))..((((((((((((......((((.(.(((.(((((.(((.(.((.(((.((((((...(((((((((....)))).)))))..))))))..))))).).)))(((..((((((((..(((...((((.((((.((((((((((((((((((((......))))))..(((.....)))..((.(((...(((((((...)))))))..))).)).....(((((((((.......))))))))).))).)))))..)))))))))).)))))))..)))))))).)))..........)))))..))).)...))))...)))))))))))).(((((((((((.((.((((..((((.....))))...)))).)))))))))))))....((((((((.......((((((....)))))).(((((.((((((((((((..((...))..)))))))))))))))))...(((((((((((.(((.((..........)).))).))))))))))).))))))))))).))).))))(((((((((((.((((((......(((....((((((.((((((.(((.((..((.(((........))).)))))))))))))))))))...)))...((((((((....))..)))))).((((((((.(((((.......((((((((..((((.((...((........(((((((...((((.......((.(((((((((...((........))...))))))))).))...(((((...(((((.....((((((..((((((((((((.(.(((.(((((((((((((((((((((((..(((((((..((....(((((.....)))))......))..)).))))).....((((((....))))))(((((((........))))))))))))).))))).......)))))))..)))))))).).))))))).........))))))))))))))))....)))))..((((.((((.((((((.((((((.....((((((((...((..((((((.((((((((((((........((((((.......((((.(((.(((((.(((.............................(((((...))))).))).)))))..))).)))).................))))))....((((((((.....)))))...)))................(((((..((((........))))))))).........................((((((.......((((((...........................))))))....))))))....))))))))))))............((((((.....)))))).........))))))))...)))))))))))))))))))).))))))))...............))))....)))))))........))...)).)))).))))).))))))))...)))))))).((((((...(((((...((((.(((.((.....)).))).)))).)))))))))))....)))))).))))))))))).............(((....)))....))))))))...((((((.(((.......(((((((.....))))))).......))).)))))))))))))
Thermodynamic Ensemble Prediction
......((((((({(((((((((,..,.||{{{,{|{{{|||||.{(((..||||},,,...,,,,,{|{,{,,{........|||||,|{{.,(((((,((((({,{((((((((,....((((((((((......)))}....,)))))),,,,|,,...{(.((((((((((((((.((((,{{((((....}}}).|||{{,({.....((((.,,,.}}||.....(((({{,,........}},)))))),.,)))).)))).))))....)))))).|}||,.|))))))).}|((((({{(((|(,{{{{{,((,{(|{(((({{|{.||,|(((((({({{{,(((({{{{,.,|||||}||||},,}}})))}.,,|||||,|,||{||...,,,||..,|.}}}}})),))})))...})})}))))||(((.,((({{{{{{||||||....,||,,,.,|{||,,,,}}}}}..,||||.,,...||||{..{,,{{{{{||...|||||{{{|||.,||||{{,((((((((((((((.{((((((...((({{{(,{{{|||.,|{{{{((..({{{{{|(((((((((((({...........(((((((((((..{{((((((..{{........}}...))))))...}}.))))))))))),.}|}}|,((((((((((.....)))).)))))).(((((...((((((...(((((.....(((((((((({.((((....)))).}))))))))))..))))).))))))...)))))...,||||,{(((((({{{,....,{{{{((({{{{{|,,|||{||{{{{,{((((({,............,))))))).,,||{|,,||||,.{{..((((((((((((((((((..{(((.{(((....(((.((.((((((((...............(((((...(((((((.(((.(((,{{{...{{||||......,(({(,,,..,|||}..,,,.,,}|||||.|||.|||....{||{{{.{|{((((((.((((((.((((.((.(((.(((.............((((((((........))))).)))(((((((.......))))))).....((((.(((((((((.{(...((((..(((((...(((((((.((...((....(((((.((((..((....((..(.(((({,(.((.,({{.((((((((.........))),}))))..})).)))))))).}..))..))..)))))))))....)}}),)))).))).....)))))..))))......}}..))))))))).))))(((.(((.(((...))).))).)))(((((.......)))))..(((((((.((......)).))))))){((((....))))}......)))))).)))))))))))).)))))).||..||,{|||,..,,,,}}})))}}}),))})))........))))))))))...))))),{,.((((((((......,,.....),))))))))|}|(((......,{((((....))))}.,,,.,||{{{{{.......|.}}}}}}..}}}}.{{{{{{{..,)))).))}))}}})))))).))).....))).}.))}}.....,|,.(((((((((...(((((((((..((((((((,.............})))))))....))))))))).})))))))).,,,..((((((.((((...((((.........)))))))).)))))).|}},.....,,,.||||||,....)},,})}.,,,..((.(((((((((.(((((.,((......,))..)))))....))))))))))).))},)},)))).))))))))).))||,||,,,,(,{,,......,..}))))}},},,,..((((((((((.((((....)))).)))))))))),))))))})}))}.}.|||,,{{{,,..,..{{{{{|,,,,,}))))),)))))),.......,(((...}}}..)))))}}}}}}})))))}...|,{|,,.,,,,...........,.,||,,..},||{{|,,,,)))}}}}},,|}}}||},,,.}}},}}}.,,,.....|,||{,{,,,,{(({{(,,....((((.....))))...})))),,...{{(,,..}||,,,........{(((((......)))))),{{{..,|,.||{{{,...{(((({(((((.,,.((((((((((((.,({,(((({.....}})}|(((.(((((....))))).)))}.....((((((......((((((((((((((.(((((....))))).,....,{.....,..)}.}}}}}.))))).)))}}}}})}{{.((({{{{....)))}...))).)}|{|((({{{|,|,,}},,},|,||..,,}}}},,,})))}},.}}}),}})}}|||||||||,,|,}||}||||||{{{||,.||,|||}||||}},}|{|||}||{||||}|,|,{{|{{{{|||||,||||||,,{({(.,.,||||.|||,|.,{,(((.((((((...(((((((((....)))).)))))..))))))..))}}|||{}||(({..{(((((((..(({...((((.((((.((({{((((((.((((((((.....,|||||}..(((.....}))..{{.{{,...({{{{{{...}}}))})..})),}||||,,|..{((({{.....,,))))}))))}))}.}))))}.,}})},)))}.))))}))..)))))))}.||,..,,,,.{{{|||||..||}.|{{.{({{{((||{{||,||||,.(((((((((((.((.((((,,(({{..,,,)))}...)))).)))))))))))))}}}}.|}))))))))))..((((((....)))))).(((((.((((((((((((..((...))..)))))))))))))))))...(((((((((((.(((.({..........}).))).)))))))))))..})),,,,}}}}}))},,,}{{{{{,(((((..,{((,......,,,,,,,||||{|,((((((.{((.{,.{((.(((........))).)))})))))))))})))))},.))),,,,,,{(({{{((({...(({,,.|||,.}}||}}}}|{{,....})))|,|||}}}}|},}})},}},||||,,.,||||||,,}}}}}}}.},,,((.(((((((((...((........))...))))))))).))..,,|||},}}||||}})}}))},,}))))))))))),.}}}|||{,.,..,|.....,|||||||{{{{..((((((((((.........(((((.{(((((..((({,{(((((.....{{,{,{{{{.{.,({{((((,(((((((,.,,....}}}))})))))))},||||}.,,.,))))}}.,},,,,|({.(((...))).))}.......,,.)))))).).)))....}))))).))))}.((((.((((((.((((((.....((((((((...((..{(((((.((((((((((((,..,..,.(({{{{......,,{{{.,{{.{{,,,.,,,...,|,...............{{{,....,||||,..|}}},.})),}|},,..|||{|||,....}}}}}},..,,,,}}}}}}...,{{{(((((.....)))))..,}}}....,.,,,...}},.(((((..((((........))))))))).,.....,....,........,...{(((((.......((((((...........................))))))....)))))),...))))))))))))............((((((.....)))))).........))))))))...)))))))))))))))))))).))))))))))))))....}}..{|||......)))),,,,,,,.,)))},.})}))))))))...))))))))))))))..,,,)||||||...,,,,,..,(({{.,,|,||...,}))})),.}))).)))))))))),....}}}},))))))))))),......)))}.))))}|..,,|||{...,},,))))||.((((((.(((.......{((((((.....))))))).......))).)))))).,,,,,,

Transcripts

ID Sequence Length GC content
AUCUAUGGGAGGAAGAGAAAGUGGAAUCUCUGUAUCAUCUUUCUUAGUC… 4295 nt 0.3844
Summary

Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human traumatic brain injury patients identified the OR6A2 as one of the top five downregulated mRNAs in brain contusion tissue compared to adjacent tissue, with a log2(fold change) of -5.46863 [Zhang et al. DOI:10.097/WNR.0000000000001756].