| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGACCAGAGUCCCCAUGGUGAACGGAACAGGUCUCCCUCACGCCGCA… | 2461 nt | 0.6002 | |
| AGCCGAGAGGUGUCACCCCCAGCGGGCGCGGGCCGGAGCACGGGCACCC… | 1865 nt | 0.5952 |
This gene encodes a member of the leukemia inhibitory factor/oncostatin-M (LIF/OSM) family of proteins. The encoded preproprotein is proteolytically processed to generate the mature protein. This protein is a secreted cytokine and growth regulator that inhibits the proliferation of a number of tumor cell lines. This protein also regulates the production of other cytokines, including interleukin 6, granulocyte-colony stimulating factor and granulocyte-macrophage colony stimulating factor in endothelial cells. This gene and the related gene, leukemia inhibitory factor, also present on chromosome 22, may have resulted from the duplication of a common ancestral gene. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
A study in mice demonstrated that the OSM is a mediator of cardiomyocyte-macrophage interaction, where it is secreted by macrophages to promote cardiomyocyte proliferation and cardiac regeneration following myocardial infarction [Bian et al. DOI:10.3892/mmr.2025.13680]. In a rat model of radiation-induced lung injury, the OSM was identified as an orthologous gene associated with inflammatory processes and was specifically noted as an overlapping gene among neutrophil downregulated genes, inflammatory response genes, and cytokine genes [Shi et al. DOI:10.17305/bb.2024.10357].