Basic Information

Symbol
ARNT2
RNA class
mRNA
Alias
Aryl Hydrocarbon Receptor Nuclear Translocator 2 BHLHe1 KIAA0307 Class E Basic Helix-Loop-Helix Protein 1 ARNT Protein 2 BHLHE1 WEDAS
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_014862.4
Sequence length
6523.0 nt
GC content
0.5310

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2365.40 kcal/mol
Thermodynamic ensemble
Free energy: -2481.85 kcal/mol
Frequency: 0.0000
Diversity: 1513.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((..((((((........))))))..).))))))((..((((((.((((((..(((((.((...)).)))))..))(((((((.(((((.((((((((....)).))))))((((((((.((...(..(.((((..((..((((((((.((((..((((((......(((((......))))))))).)).)))).)))))))).....))..)))))..)...)).))))))))(((((((...)))..)))).)))))...)))))))(((.....)))((((......)))).))))..))))))..)).....((((.((((((.((((((((((((.((((((((............((((........)))).((((....))))(((((((...((((((..(((((((((((.((.(((.......)))..))...((((.(((((.(.((........)).).))))).))))(((((((..((((.(((((...(((........)))(((((..(((...))).))))).....((((((((((((....((((((.(((.((.(((...((.(((((((((((..((((((...(((((....((.....))...)))))))))))(((..(((.(.(((((((...((.(((.(((.((((.((((....)))))))).))).))).))...(((...(((((.(.(((....))).))))))....))).....(((((((.....))).))))..))))))).))))..)))........)))))))))))))...))).)).))).)))).)).((((........))))))))))))))))(((.....)))..((((((...((((((...................))))))..))))))))..))).)))).)))))))......((((((...(((.((((.(((((((((.((((((..((((((.(((..(((.((((....))..)).)))..))).(((((((....(((((((((.(((((((.....((((((....))))))..((((...((.((.((..((..(((.(((..((((.(((((.......))))).))))..))))))..))..)))))).....))))((((((.((((((((((.(((.(((...))).))).)))))).((((...)))).((((((....))))))..(((.(((..(((......(((((..(((((.....((((((((((.((........)))))))))))).(((((((.((((..((...((((((.....))))))...))..........((((((((((((((.(((((....(((...........((((((....))))))..(((.((((((.((((((((((((.((..((...(.((((((..((((((((..(((..((....))....)))......((((.((((((.((((......(((.(((..((.(((((.((.((...((((....))))....)).)).))))..).))..))).)))...))))))))))))))((((((......)))).)).)))))))).))))))).))..)).)))).((......)))))))))).)))))).)))))).)).)))...)))))..)))))))))..((((......)))).((((((...))))))..)))))))))))))))))))))))).))))))(((.(((((...))))).)))...((((((((((((.(((((.((((...........))))........((..(((((((((.((((.(((((((.((...(((.....)))((((((..(((.(((((((........(((...)))........))))))).)))..(((((.(((......((......)).(((((....(((((((.....((((.(((((..........((((((....))))))(((((((((....)))))))...))(((((((...)))))))...))))))))).......)))).)))....)))))((((((((((((.((...((((......))))(((.(((((((((.((((((.(((....((((...((((...))))...))))...)))..))))))...((((((....(((......)))..)))))).............((((..((((......)))).)))).)))))))))))).)).))))))))))))))).))))).))))))((((((.......))))))....(((.(((((((((((..(((((((..(((.(((((((((((((((..(((.(((((.......(((((((.((...(((((((((((((..((((((.....((((((...(((((((.((((...((((((.((.((((......(((((((((((.((((...(((((((((.......)))).)))))....)))).))).)))).(((((((...((((((...((((((.(..(((.((.......)).)))..))))))).))))))....))))).))...))))..)))).)).)))))).((((((..((....(((((.(.(((((.((((.....)).)).)))))))))))..)).))).))))))).)))))))..((((((((...((((..(((...)))...))))...)))..)))))))))))...((.((((((((((.(((.((.((.((.....)))).)).))))))..))))))).))...))))))..)))))))...........)))))).)).)))).)))((((((((..(((.((..((.((((..(((((.(((.(((..(.((((((.((((......))))).((((.((.(.((.((((.......)))).)).)...)).)))).......(((((...((((...)))))).)))(((((...))))).))))).)..)))))).)))))...)))).)).)))))..))).)))))..))))).)))...)).)))))((((((.((((((((((.((.((((((.((((...((((.((((((((((((((((((......)))))))(((..((.((.....(((((...........)))))....(((((.(((((....)))))..))))).((((....)))).........)).))..)))))))))))))).))))...)))))))))).))...)))).....(((....))))))))).))))))....(((((....))))).)))))))))))..)....)))))).)))))))))))...))).))))))))))))).)))))))))..))..)))))...)))))..)))))))(((((((((..(((((((.(((((.(..((((....((((((((((...((((..(((((((.(((((.........(((((((............)))))))..........))))).))))))))))).....))))))))))))))..)))))).))).....)))).))).)))))).((((((........)))))).....)))).)))))).(((((....)))))....))))))).)))))))..((((((....)))))).(((((.((((((...(((...(((((.((((((.........(((..(((((((...........))).......((((.(.((((((...((((((((((((((.((((((.....((((((..(((((((((.((((((((((((((..((......))...)))))))).......)))))))))))((((...))))................))))...))))))))))))(((((.((((.(((((((..(......)..)))))))..)))))))))(((((((((((((...(((((..((.((((((.(.((((.((((.((.....)).)))).))))..).)))))).))...)))))))))))..(((((((((...((........))(((((..........((((.......(((((((...((((...(((((((...))))))).)))).)))).))).....)))).........)))))(((((((((.................)))))).)))...)))))))))((((((......))))))..)))))))..((((((((((......)))))))))).((((.((((((((.....(((.(((((..((((((((((..((((.((((.(((((((.((((....((((.(((..((((((...(((.((((.....))))..)))...)))))))))...))))((((.(((..((((((((((((..(((((....(((((.((((...((((..(((((.(((......)))))))).)))))))).))))).....)))))..))).....)))))))))....))).))))....(((((..........)))))))))..)))))))))))..)).))...(((((...(((((....)).))).))))).....)))))).....)))).))))).))).((((((((((.(((........((((.....)))))))))))......((((.((((((((((....)))))..)))).).))))..))))))((.((((((((((...((..(((((......)))))..)).(((((.((((((((((....................)))))))((((..((.(((((......)))))...)).))))(((((((((((((.(((....))).))))))))).))))............))).)))))............((((((..(((((((((((..(((.((((((((((((((......((((...))))..........)))))))........((((.((..........)).))))(((((......))))).(((((((.....((((((..(((((.(((.((((((((((((((((((((....)).))))).((((((.((((.((((((((.(((.....(((((.((..(((((((....))))).))..))...))))).((((...(((((((((.....((.((...((...))...)).))......))))(((..(..(((((((((.(((..(((...((....))...))).))).)))))))))..)..)))))))).))))...((((((....((....)).))))))))).).))))))).....))))))))))......))))..))).))))))..))).)))))...))).)))...(..(((((((((((((....(((((((((((((((((((.((((........))))..)).....))))))))).))..((...((((((((...(((.((((((((((((((((..(((........)))........(((((...)))))))))))..)))))))))))))...))))))))...))....((((.((((((.....)))))).)))).....))).)))....))))))..)))...))))..).))))))).......((.((((.((....))..)))).))..)))))))..)))............))))))).)))).((((((((((.((((((((((((......(((((...((((....)))))))))((((((((((((((..(((...........))).)).)))).)))).)))).....(((.(((((((((..((......))..)))......)))).)))))...))))))))..)))))))).))))))............((((.....))))......))))))...)))))).)))).))))))))))..)))).)))))))))...)))))..)))))).))))).......))))(((((((...))))))).))).(((((.((((.((.(((((((((((((((((((((((.(((....))).))))).)))).)))))))))........))))).)))))).))))))))))).)))))...)))))))))...)))))...((((.(((((((........(((((...((((((((............)))))))))))))....)))))))))))(((((..(((......)))...)))))))....)))))))...))))))..)))))).))))))....)))..))))...)))....))))))((((((...))))))..)))))).))))).))))))..))).))))...))))))))...))))))))).........))).))).)))))))...
Thermodynamic Ensemble Prediction
(((((((((((((((........))))))}))}))))))..((((((((.((({((..(((((.((...)).)))))..))(((((((.(((((.((((((((....)).)))))){(((((((.((...(..(.((((..((..((((((((.((((..((((({.,,,..{{{{{.,,,..)))))}}}}.)).)))).)))))))).....))..)))),,.}...)).)))))))|(((((((...)))..)))).)))))...)))))))(((,...,)))((((......)))).,)))..))))))}))......(((,{(((,((,((((((((((((.((((((((,{,{{{{,,,..(((({{..,||.}||}.{(({,,,,|||}.((((,....,.}}||.(((...((((((....))))))....)))..,,,,.({((.(((((.{.{(........)).|.))))).)))}{((((((..((((.(((,.{{.(((........))),||,({({({...|,|,|}}},.....((((((((((((....((((((.(((.((.(((..,(({(((((((((((.{{(,{((.,{({(((....,|,,},.})},.))),|||||,{(((..(((.(.(((((((...((.(((.(((,((((.((((....)))))))).))),))).)).,.(((...(((((.(.(((....))).))))))....))).....(((((((,...,))).))))..))))))).))))..)))}...,}}}))))))))),)))},,))).)).))).)))).)).((((........)))))))))))))))){{{.....))},,((((((...((((((...................))))))..))))))))..})).)))).)))))))...,,,|||||{|},|.,..|||||,|((((((.((((((..{(((((.{{{{{{({,,.,|..{{||..,...,},.)))|{((((({....{.(((((((.(((((((.....((((((....))))))..((((...((.((.((..((..((,{(((..((((.(((((.......))))).))))..))))))..})..)))))).....))))((((((.((((((((((.(((.(((...))).))).))))))}|(((...))},.((((({....})))))..{{{,|{|,,|||,...,,{|{(({((((((,....((((((((((.,(,,....})},)))))))))).,((((({{((((..,{...((((((.....)))))).,{,......},,..((((((((((((((.(((((..{{(,.({,,,.,,...((((((....)))))),,|{|.,(((((.((((((((((((.{{..((...(.((((((..((((((((..{{{..({....}}....)))....,.((((.((((((.((((......(((.(((..((.{((((.((.((...((((....))))....)).)).))))..}.))..))).))),},))))))))))))))((((((......)))).)).)))))))).))))))).))..}}.)))).{(......}}}))))))).)))))),,,)))..)).)))...))))}..)))))))))..((({,....,}))).,{{(({...}))))),.))))))))))))))))),))),}},}}}}}}(((.(((((...})))).)))...(((((({(((((.(((((.{{{{...........))}}......,,{{..(((((((((.((((.(((((((.{{...(((.....))){(((((..(((.(((((((...,,...(({...)}}..,,....})))))).))}..(((((.(((......((....,}},.(((((....(((((((.....((((.(((((..........((((((....)))))){{(((((((....)))))))...))(((((((...)))))))...))))))))).,.....)))).)))....)))))((((((((((((.((...((((......))))(((.(((((((((.((((((.(((....((((...((((...))))...))))...)))..))))))...((((((....(((......)))..))))))...........{,{({(..((((......)))).))))})))))))))))).)).))))))))))))))).))))).)))))|((((((.......)))))),.....{.(((((((((((..(((((({..(((.(((((((((((((((..(((.(((((....{(((((((((.((...(((((((((((((..((((((....,((((({...(((((((.((((.{.((((((.((.((((......(((((((((((.((((.{{(((((((((.......)))).)))),.,}})))).))).)))).(((((((...((((((...(((({{{(.,(((.({.......}).))),.))))))).))))))....))))).))...))))..)))).)).)))))).{(((((..((|...{|||{,|,||{{{.{(((.....}},,}.,}))}}}))})..)),))),))})))).)))))))..((((({({...((((..(({...)))...))))..,))}..)))))})))))...{{.((((((((((.(((.((.({,((.....)))).)).)))))),.})))))).}}...))))))..)))))))...........)))))).)).)))).))).}}|(((....))),,.((((((((((.(({{,{{({{((.{({{(.{{{{{{{{......},}},..,.,,}},,.,|.||||....,.{{|{|{{({{{,,,.((((((((.((.{.((((.{(,((.{,|},,,}}}))}},,.))))}))}.)))))))}..,,))},,}},}...)))))))}))))).))))))))))..))))).)))...}}.)))))((((((.((((((((((,((,((((((.((((.,.((((.(((((((((({(((((((......))))))){,,..{{,|,....,(((((........,},)))}}....(((((.(((((....)))))..))))).,,,,..{.|||,..,,,.,.}}}.,,..,))))))))))))).)))).,.)))))))))).,|{{.||,,.,,..|||},}.))))))))).))))))....(((((....))))).)))))))))))..}....)))))).))))))))))).,.,},.,,))))))))))).)))))))))..))..)))))...)))))..)))))))(((((((({,.(((((((.(((((.{{{((((....((((((((((..{((({..(((((((.(((((,........(((((((............)))))))........,.))))).))))))))}))}}...)))))))))))}))}.}))))).))).....)))).)))}}))))).{(((((,,......)))))),,,..,))).)))))).(((((....)))))....))))))).)))))))..((((((....)))))).{{{{{.{||{{|..|({(,.,{{{{(.{{{{((,{{..,,,.{{{,,{{{(((({{,,,...,,.,||,,.....((((.(.((((((,{.((((((((((((((.,(((((((.((((((((,.({(((((((.((((((((((((((..({......},...)))))))).......)))))))))))((((,{{||||{{{........},,.,|}|)||}},}))),|||},.||||}|||{.{{{{{,{..|.{{{,.,{{|}}||||,.,,,|.((((((.(.(((((((.((((((((((((((({(((({..((({..,,,,...,..)),}....,))))}.......(((((((..,{{..(((((,((....)).)).)))..}},..)))))))....,{{{..(((((((((..(.(((.,,,..(((((((..((,,{{.((((((..(((.((((((((({..,(((((((,,((((..{((,.{,{(((((...,,{{,,,.,,,.,,)))))},}},,{(((((({{.(((((((......))))))).,,|,,|||.((((((((((......))))))))))...,{(((((.(.......)))))).}|((((((((((((((((((......)))}..{{(.((((..((((((((((((((((.,.(((.((((.....))))..))).,.))))))|{{...{{(((,{{.,,...((((((((((((..(((((....(((((.((({..,((((,.(((((.(((......)))))))).)))))))).))))).....)))))..))).....)))))))))...})}}}}))},..}}|((((((,,.....)})))))}(((((((,.,,,,,,{((,(({..(((((...(((((...,{},}},.})))).,,,))}}}|{{{{{{,,..|,|||{,,.))))}},}})))})}........(((((((((..,.{((....)}}.)....)))))))))}))))))|)))}..}))))))))).}}},...,,,},))))))),))}.})))}|{{||,,,,}}),}}}..,.}|}}|||}}{{((((((.............||,,...))))))||{((.,({,(((((......)))))...)).)))},...)))))))))))))))))))))),,))).{{{{{{..||...,)).)))))){((.(((..(((..((((((((.((({,{(((......))).((..((((((..((,,...,(({{{.((((((({........,.{(({{.......,)))}},.......})))))))..(((((......)))))))}.})}....))..)))))).,)),,,.,,{,((.((((...}))),))...,))))).))))))))..)))..))).))}..(((((.(..((((((((......)))).))))..).)))))...)))))).,,.},..)}..})))))).}},))))..))))))))).)))))))).)))))).))(((..(((((...{,...{((((.(((((..(((((((.....)))))))....((((((..(({......}.})..))))))...||....,,.,,({{.(((((.((((((((.((((..{,,,.(((((((((((.((((...{(({({.((((((((....(({{(({({.,..|)))}..,{,....})))})),}.,(((((((((,(,((((........)}},..)).....))))))))).)))))))).((((((((.,.(((.((((((((((((((((..(((........)))........(((((...)))))))))))..)))))))))}))).,.))))))))...}.,))}}..))))))))))))))).....|||{,.....{{||,|{{,,{{,....},...}}).},}},,}),...)))).)))))))))).)))...))),.)))))...)))))}.)))))..)))))).)))))))))))))).,(((((((((((((((((((((((.,,,..(((((...((((....)))))))))((((((((((((((..(((...........))).))})})).))))},)))..},,{((.((((({,,(,,{(......}}..))}.}},..}}}}.}}}},...))))))))..)))))))).)))))),}},,,}}}}}}((((.....))))........,,|,......,)}))))))).|||,,..))......)))))))))...))))).})))))).)))))..,....})))(((((((...))))))).}||.{{{{{.{{{(.{{.{({({((((((((((((((((((.(((....))).))))),,))).))))))))).....,}}))))).}))))).}}))}))}}}}.)))))...))))))))),,.))))),,}({{|{(((((((.,,.....(((((...((((((((............)))))))))))))..,,))))))))))){||||,,(((......)))...)}})),},}},))))))),,}))))))..)))))).))))}}...,||||||,......})},}}}}}},,|{((({...}}}}}}..})}}}}}}}}}|.|||,,|..|}..,})),,,})))))))...))))))))}........,))).))).)))))))...

Transcripts

ID Sequence Length GC content
GCCGCCCGCCCGCGCCGUCCUUUGUGUGGCGGCGGCGGCGCCUGGGCCU… 6523 nt 0.5310
Summary

This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]

Forensic Context

A study in mice identified the ARNT2 as a nucleus accumbens shell (NAcSh)-enhanced transcript through a novel two-step topographic transcriptomic analysis [Crofton et al. DOI:10.1016/J.Neuropharm.2020.108398].