Basic Information

Symbol
OSTM1
RNA class
mRNA
Alias
Osteoclastogenesis Associated Transmembrane Protein 1 GL HSPC019 Osteopetrosis Associated Transmembrane Protein 1 Osteopetrosis-Associated Transmembrane Protein 1 Chloride Channel 7 Beta Subunit CLCN7 Accessory Beta Subunit GAIP-Interacting Protein N Terminus Grey-Lethal Osteopetrosis Grey-Lethal OPTB5 GIPN
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_014028.4
Sequence length
4471.0 nt
GC content
0.3713

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1250.77 kcal/mol
Thermodynamic ensemble
Free energy: -1336.73 kcal/mol
Frequency: 0.0000
Diversity: 1206.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((...(((....)))...))))(((((((..(((((((((((.....((((((((.(((((((...((.(((..(.(((((((......))))))))..))).))(((((((.(.((((........)))).).)))).)))..((((((((((((.((..(((((..(((...)))..))))).)).))))))))))))..((((((((((((((...((((....))))((((....))))...)))))))).....))))))((((((........))))))..))))))))))))))))))))).((((((..(((...((.(((((.....)))))(((.(((.(((......))).))).)))((((..((((((((((((((((.(((...))))))).....))))).)))))))..)))).....))...)))..))))))........((((.....))))))))).)))))))((((((.(((((.((((((((((((((((((((((((...(((((..(((.(((((((((.((((.(((.....))).)))).)))....((....)).((((((...(((((((..((((((........))))))................)))))))...))))))....((((.........((((((...................))))))........)))).....(((((((.......((((((((.((((((....((....))...)))))).....)))))))))))))))..((((((((.(((.(((((.((..((((........((((..(((((((((((((........))))))...((((.......))))..(((((((....(((.(.((((........))))).)))...((((.((((((((.......)))).)))).))))(((.(((.((((((((((.(((((((((((((......((((((((............)))))).))....((((((.......((((.....(((.(((.(((.(((((......(((((...........))))).....))))))))...)))))).....))))))))))..)))))))))))..))..)))...))))))).))).)))((.(((((((..((((....................)))))))))))))..............)))))))..............((((..(((.......)))..))))..........)))))))..)))).((((..(((...(((.((((.......)))).))).))))))).))))..)).))))).)))))))))))..)))))).))).)))))..))))))))))))).............(((.((((((((((.....((((((((((........))))))))))...((...((((((((.(....(((((((((((...((((((.(((...((((...(((((((((......((((((((((.((.((((..((....))..)))).)).))))))))))........((((((..(((((..((((((...........(((.(((.(((((..(((.((((.((((.((((((((((((((((..(..(((..((((((....))))))..)))..)..)))...))))))..))))))).)))).)).......((((.....((((((((((.....((((((((((........))))))))))....)))...)))))))...))))...........)).)))))))))))))).................((((((((((..........((((............)))).................))))))))))..(((((((((((....))))).)))))).........)))))))))))..)))))).)).)))))))....)))).....))))))))).....(((((((((((((..........((((((((((.(((((((((.((((.....((((((((.((.......(((((((((..........))))))))).))))))))))....(((((((((((((((((((..((.......))..)))))))))))....(((.....(((((.(((((......))))))))))..))).......))))))))..)))).))........))))))))))))))))))))))))))))))...(((((((.((((.(((.(((((...((((((.(((((..(((((...(((.(((((................))))).)))..)))))..)))))))))))....)))))))))))).)))))))..(((((((((.............))))))))).......)))))))))))......).))))))))...)).(((((((..(((((((((((..(((((...(((((((........((((((((((.....(((((.(((...(((........(((.(((.(((((...(((((.((((((((..((((.((((((((.(((((((((((.((((..((((((((..((..((........))..)).))))..))))...)))).))))...))).)))).))))).((((((((.((((...(((((((((((((((.(((...))))))).((((((((((((((..(.(((((((....))))))).)...((((((.....((((((((..........((.(((.((((.(((((..(((....(((((((((((((........))....)))))).)))))...))).))))).)))).))).)).))))))))...))))))(((((((.(((...))))))))))..)))))))))))))).((((.....))))........)))))).)))))....(((((((((.....))))).))))(((((((...((((.....))))...)))))))((((.(((((((......))))))).))))(((((......))))))))))))))))).(((((((.......)))))))((((....)))).))).))))..)).)))))).).......((((.((.(((((((((((((((((((.(((((((.((.(((((((.(((((((((((((((.(((.(((((((((((.((((((((((((((((((..........((((((((..((..(((....)))..))..))))))))..........(((((((((.(..((.(((..(((((((.((((.(((.((((((........)))))).).)).))..))..)))))))....))).))..))))))))))((((((((((((((((((((((((((((((...((((((((((((.(((.((...((((((..............))))))...)).))).))))))..............))))))....)))))))))))))))........))))))))))))))))))))))))))))))))).))))))))))).))).))))))))))))))).))))))).)).))))....))).))))))))))))))))))).)).))))))))))))).)))))).)))....))).))))).....))))))))))..((((((((((((((...((((((((((...((((...((((.(((((.......))))).))))))))......(((..(((((((((.((((((((.((....)).))))..)))).))...)))))))..)))...))))))))))......))))))..(((((((((((...............................)))))))))))...................((((((.(((((........)))))...)))))).........((((((....((((...((.(((.(((....))))))))...))))....)))))).......)))))))).......)))))))(((((((((..................)))))))))..)))))..))))))......)))))....)))))))((((...))))((((.....)))))))))))))).)))......((((....))))..(((((...)))))....(((((((((.......)))))))))....)))))))))))...))))).......(((((((......))))))).................))))))....(((((((.....)))))))..((((.((((((((((...)))))...))))).))))....((((((..((....))..)))))))))).............
Thermodynamic Ensemble Prediction
(({((((({..(({..,,,.,|}|.|.|}}}}||,((,,((((,,(((((((..,((((((.((((((((..((.(((..(.(((((((......)))))))},,))).))(((((((.(.((((........)))).).))))}}))..((((((((((((.((..(((((..(((...)))..))))),)}.)))))))))))){{(((((((((((({{.,(((((....},||(({,...})))))}}))})}||||....,||,}}||{(((.{{{{{.,||,|||{.|,|||,.,,))).),))))))|,,}||}}.||}...}}}}}}},.},,)})))))})))})))),.)})))))..)))).))((((..(((((((((((({(((.(({...}))}})),,.,.))))).)))))))..))))....(((((((((({{{{({,,((((((.,((({{{{.},,|(((((((((,((({({.,,,,,(((({{(((({((..,(((((,{((,,,,},..}))}}{|.{(((((({,....})})|})))}.}},,|,,,.,,...,,(({,,,(((((((((.{,(((((((..,(((((,....,,,)},,||{,.,,....,,.....}}}}}}}...,}}}}|,,,.....,,,......((((((...................))))))...|||||,..{{,,..(((((((.......((((((((.((((((....((....))...)))))).....))))))))))))))).{(((((((,{....,,(((,{((((((((((((({{(((({((((((((({{{((..,,,,,,}}}}}}...|||||,.{{{{,,{|((((.{......,.)))}.||,,..,,.{{{||||{{,|.{{{((((((({{,(((((((((({{((({({{{((({{{{.{{(,((((((((((.(((((((((((((......((((((((.......,}...}))))).))....((((((.......((((.....((({({(.(({,(((((......{((((...........))))).....))))))))...,}}))).....))))))))))..))))))))))),}}}..)))...))))))).))}.}}}{(.(((((((..((((....................))))))))))))}..,......{{{{{,....}}.,,}},,,......((((..(((.......)))..))))...........,,}}||,{|}||.|||||,,......||,{(((....,,,)}}}...)))))))).))))|.....,,...........)))))))))))}}.,..}},....|},,,,}}}||||{(((({.((((((...((((.((.......((((((((((..,,,(,,,.,{,,.....,}},.}))),...))))))))))......)).))))...)))))).....((((...(((((((((......((((((((((.((.((((,.{{...,)),.)))).}}.))))))))))........((((((..(((({{,((((((.,{,.,.....(((.((,{(((((,,({{.{{{{.((((.((((((((((((((((..(..(((..((((((....))))))..)))..)..))),..})))))..))))))).)))).||.......,,{,.....(((((((.{{...,,((((((((((........)))))))))).,..,.}...))))))).,{|||,......,}},,)},)),))))))))))).,,..,....,},....((((((((((.,...,,...((((.,{......},.))))....,.......,.,..))))))))))..{(({{{(((((....))))).}})))}.....,}}.))))))))})),,)))))).)).)))))))....))))..{{({{{.,|.....,...,|||||||||||}}}}}}}}}}|||||{{{||}|||||||((.((((.....((((((((,((,...,,,{((((((((..........))))))))}.},))))))))....{(((((({(((((((((((..((.......))..)))))))))))....,,(,,...(((((.(((((......))))))))))..})),,.....}))))))}..)))).)))}}}}}}..,,))))}}))))))))))))))))))),,...|}}}|}.}})))))}.....||||}|}||}|}|....,})}}|}}|||{||{{{{|{{{,,{{{{,{{{{.,,,....,.{,{{({{{{{|||{{{{{{|,..,,}},,(((((((({{{{{..,,,(((((((({.........,...))))))))).,,},...}))))))))},,,..,})))),}}}}}}))))))||,|,,||....{(((,{{{{{{({,,.}))}.},}}}.))))|||,||||{{|,,}||||,}.,,})})}},|,}},..,|}}))},}}}}}}.,,,}|}}....}}}}}}|,,||}|||,{(({,((({(((((({.{{{{..{{{{,{{{|,|{|,{{.......,})..})})))}.,}})).,.}}}},)|||,..}||,}|||{|||||.{{,.,|,,..,.})}}||||||||,|||(((.{{{...})))))).((((((((((((((..(.(((((((....))))))).}...((((((..{..((((((({....,,....((.(((,((((.(((((..(((..{{(((((((((((,,........}}....)))))).)))))})}))).))))).}))).))).})})))))))).}.))))))(((((((.(({...})))))))))..)))))))))))))).(({{.....))))......||||||}},,)))),,.{(((((((((.....))))).))))}{{{{{(({{((((((((({{{{{,,.,.|||{((((.(((((((......))))))).))))|||{{......}}}}}.....}}},...,((((((({{,....||||,,|{{{{...,})))}.}}}}.((((....))))}.))))))},{(((.((.(((((((((((((((((((.(((((((.((.(((((((.(((((((((((((((.(((.(((((((((((.((((((((((((((((((,.........((((((((..((..(((....)))..))..)))))))).|,.......(((((((((.(..((.(((..(((((((.,{(({(((.((((((........)))))),).}),)},})),.)))))))....))).))..)))))))))){((((((((((((((((((((((((((((({{,((((((((((,,.,,{,.{.(((((((({(((.{,...,}.})).)))})))).)}}.,),,))}}}}}}........)))}))}.,.}))))))))))))))........))))))))))))))))))))))))))))))))).))))))))))).))).))))))))))))))).))))))).)).)))}...,))).))))))))))))))))))).)).)))}{(({{{{||.,......,||(({,{{,|,}||.....,..,))}))))}((((((({.((((((...((((((((((...((({..,((((.(((((.......))))).))))))))......(((..(((((((((.((((((((.((....)).))))..)))).))...)))))))..)))...))))))))))......))))))......{(((({{{..,,,..,{{{{{{{{{....,,,,,,...{{{{,...}}},,...}}||||{{{,.,..((((((.(((((........))))}...)))))){{{{{,{..((((((....((((...((.(((.(((....))))))))...))))....)))))),.},}.,|||{....}}}}...||,...,{((((((({...,..,,,..,.,,...}))))))))),}|||{..,(((.(((({{{{{{..,..((({.....)))},||...||.,}}}}})))))))}|||||},||.......((((....))))..{{{{,...))))),,,,,,,,,||||}}}}}}.})),)))))},,}))))))))))))))))},........(((((((......)))))))....,,,..}})))))))))}......(((((((.....)))))))..{(((.((((((((((...)))))...))))).))))..,}}}}}}}}.,,.}))))....,))))))..............

Transcripts

ID Sequence Length GC content
GCUCGCGGAAACCGGAAGCGGCGGCUGUCCGCGGUGCCGGCUGGGGGCG… 4471 nt 0.3713
Summary

This gene encodes a protein that may be involved in the degradation of G proteins via the ubiquitin-dependent proteasome pathway. The encoded protein binds to members of subfamily A of the regulator of the G-protein signaling (RGS) family through an N-terminal leucine-rich region. This protein also has a central RING finger-like domain and E3 ubiquitin ligase activity. This protein is highly conserved from flies to humans. Defects in this gene may cause the autosomal recessive, infantile malignant form of osteopetrosis. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the OSTM1 was downregulated in subcutaneous adipose tissue during both short-term and long-term weight loss in obese participants, and this downregulation was associated with decreased adipogenesis [Bollepalli et al. DOI:10.1038/ijo.2017.245].