Basic Information

Symbol
ARPC1A
RNA class
mRNA
Alias
Actin Related Protein 2/3 Complex Subunit 1A SOP2L SOP2-Like Protein SOP2Hs Arc40 Actin Binding Protein (Schizosaccharomyces Pombe Sop2-Like) Actin-Related Protein 2/3 Complex Subunit 1A Actin Related Protein 2/3 Complex, Subunit 1A (41 KD) Actin Related Protein 2/3 Complex, Subunit 1A, 41kDa Actin Related Protein 2/3 Complex Subunit 1A, 41kDa Epididymis Secretory Sperm Binding Protein Epididymis Secretory Protein Li 307 Epididymis Luminal Protein 68 HEL-S-307 HEL-68
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Drug abuse diagnoses

MANE select

Transcript ID
NM_006409.4
Sequence length
1582.0 nt
GC content
0.5013

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-517.00 kcal/mol
Thermodynamic ensemble
Free energy: -540.58 kcal/mol
Frequency: 0.0000
Diversity: 248.77
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((..(((((....(((((.(((((.(((...((((((..(((((((..((((......))))))))))).....)))))).(((((.(.((.(((((.(((((((...((((........))))....(((((((.((((....))))..)))))))((((.((....(....)....))))))....))))))).....(((((((.((..((..........))..)).))).))))...........))))))).))))))....((((.((....))..))))...((((.((((....((((((((.....((.((((.(((.(((......))).))).))))))......)))))))).(((((((((.....((((((.((((.(((.(((((.((.((.....(((((......((.((((((....(((((....(((......)))....)))))...)))))).)).(((((((.((.((..((..(((((((((((((.((((.......)))).).)))))).))))))....))..)).))....)))))))....))))))).)).))))).))).)))).))))))((((((.((....((((.(.(((((.(((((((((....))))))....)))...))))).)))))...))..))))))..(((((((((((......))))....(((((((((..((((((((...(.((((((((((..(((((((...(((((..((((........)))).))))))))))))(((((..((.((((((((((.((....(.((((..((((((((((.....((((.(((((....(((((((....))))))))))))))))....)).))))))...))..)))).)...))))))))))))))))))))).)))))))))...))))...........))))..)))))))))(((....))).........((.((((((((...((((.((((..(((.......)))..))))..))))((((..((((((..(((((.......((((((.(((.....))))))))).((.((((........)))).)).......))))).))))))..))))....((((((((......)))))))).....((((.((....))))))......)))))))).))(((((......)))))....)))))))))))))))).(((.(.((((.(((.((....))))).)))).).)))..((((((....)))))).))))))))))).))..))))))))....)))))..)).............(((((.....((((((((....(((((((((......)))))))))......))))))))..........((((...(((((((((((.((((((((((((((((....(((((.(((......(((.((((((((((....((........))....))).))))))))))...))).)))))...))).))))))).....)))))).))))))))))))))).))))).
Thermodynamic Ensemble Prediction
,{.,(((((..,.((((,{(((((.(((.,.((((({..(((((((..((((......))))))))))).,,,,)})))).(((((.(.((.(((((.(((((((.,.((((........))))....{((((((.((((....}))}..))))))}((((.((....,....}....))))))....)))))))..,,.(((((((.((..{{..........}}..}).))).}))}...........))))))).))))))....((((.((....))..))))...((((.((((....((((((((.,.((((,((((.(((.(((......))).))).))))))...)}})))))))).(((((((((.....{(((((.((((.(((.(((((.((.((.....(((((..,...((.((((((....(((((....{((.....,))}....)))))...)))))).)).(((((((.((.((..,,..((((((((((({{.((((.......)))).}.})))})}))))))....,,..)).))....))))))),,,.))))))).)).))))).))).)))).)))))|((((((.((....((((.(.(((((.(((((((((....))))))....)))...))))),,))))...))..)))))),.(((((((((((......))))....(((((((((..((((((((,,(({(((((({(,...(((((((...(((((..((((........)))).))))))))))))(((((..((.((((((((((.((....(.((((..((((((((({.....((((.(((((....(((((((....))))))))))))))))....}).))))))...))..)))).)...)))))))))))))))))))},}))))))))},,.)))),..........})))..))))))))){{{....}}}.........((.{((((({{...{(((.((((..(((.......)))..))))..)))|((((..((((((..(((((.......((((((.(((.....))))))))).((.((((........)))).))......,))))).))))))..)))),...((((((((......)))))))).....((((.((....)))))).,....}))))))}.)){((((......)))))....)))))))))))))))).{((.(.((((.(((.((....))))).)))).).)))..((((((....)))))).))))))))))).))..)))))))).,..)))))..}),...,,{.,,,{{(((({.{,,(((((((,,.,{{{|||{{,,,....,,))},,)))))))...)))}}}}}}}},...,..(({{..,(((((((((((.((((((((((((((((..,.(((((.(((....{{({(.((((((((((....,(,.......,}....))),})))))))))...))).))))),..))).))))))).....)))))).)))))))))))))))..}})}.

Transcripts

ID Sequence Length GC content
CUCUGGGCUUCCGUCCUCCGCCCGCGCCCGACGGAGCCUGUUCGCGUCG… 1580 nt 0.5013
CUCUGGGCUUCCGUCCUCCGCCCGCGCCCGACGGAGCCUGUUCGCGUCG… 1582 nt 0.5013
Summary

This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Forensic Context

A study in mice demonstrated that the ARPC1A gene, associated with focal adhesion and actin stabilization, was significantly upregulated in oligodendrocytes following chronic methamphetamine administration, as identified through single-cell RNA sequencing analysis [Oladapo et al. DOI:10.3390/Ijms26020649]. A study in mice demonstrated that methamphetamine treatment induced inflammatory bowel disease-like pathology and transcriptomic changes in ileal tissue, with the ARPC1A being implicated in the associated focal adhesion and actin stabilization pathways [Sun et al. DOI:10.21037/Atm-20-7741]. In human traumatic brain injury, microarray analysis of pericontusional tissue revealed differential expression of genes encoding contractile and cytoskeletal proteins, including other subunits of the actin-related protein 2/3 complex [Michael et al. DOI:10.1016/j.jocn.2004.11.003].