| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCUGGGCUUCCGUCCUCCGCCCGCGCCCGACGGAGCCUGUUCGCGUCG… | 1580 nt | 0.5013 | |
| CUCUGGGCUUCCGUCCUCCGCCCGCGCCCGACGGAGCCUGUUCGCGUCG… | 1582 nt | 0.5013 |
This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1B. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]
A study in mice demonstrated that the ARPC1A gene, associated with focal adhesion and actin stabilization, was significantly upregulated in oligodendrocytes following chronic methamphetamine administration, as identified through single-cell RNA sequencing analysis [Oladapo et al. DOI:10.3390/Ijms26020649]. A study in mice demonstrated that methamphetamine treatment induced inflammatory bowel disease-like pathology and transcriptomic changes in ileal tissue, with the ARPC1A being implicated in the associated focal adhesion and actin stabilization pathways [Sun et al. DOI:10.21037/Atm-20-7741]. In human traumatic brain injury, microarray analysis of pericontusional tissue revealed differential expression of genes encoding contractile and cytoskeletal proteins, including other subunits of the actin-related protein 2/3 complex [Michael et al. DOI:10.1016/j.jocn.2004.11.003].