Basic Information

Symbol
P2RX1
RNA class
mRNA
Alias
Purinergic Receptor P2X 1 P2X1 P2X Purinoceptor 1 ATP Receptor Purinergic Receptor P2X, Ligand-Gated Ion Channel, 1 Purinergic Receptor P2X, Ligand Gated Ion Channel, 1 Purinergic Receptor P2X1 P2X Receptor, Subunit 1 Purinergic Receptor P2X1 Receptor
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_002558.4
Sequence length
2662.0 nt
GC content
0.5748

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1078.50 kcal/mol
Thermodynamic ensemble
Free energy: -1122.50 kcal/mol
Frequency: 0.0000
Diversity: 584.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((.((((...((((...((((...(((((......)))))...))))))))..............((((((.((((((((((((((((((.(((.....((((((.(((((((((((....(((((((.((..(((.(((...((((.......)).))...))).)))..)))))...)))))))))))).))).))))))((((((((....)))))))).(((((((......))).))))((((.(..((((..((((..(((((.(((...(((...(((((((((((.((((.(((((..((......(((((((.....)))))))....))..)))))..((((.......)))).)))))))).))))))).)))...))).)))))..)))).))))..).))))....((((((.(((..(((.(((((....(((((.(((((...(((..((((.(((((.((...))))))).))))..)))((.((.((((((((.(((((((((((.(((.((.(((((.((((((((.........)))))))).))))).)).......(((((((((((..((.(((....))).))...)))......).)))))))))).))))))))..((((........)))).(((((...(((((......)))))..)))))........))).)))))))))).)).......(((((((((..((.((((((.(((.((((......(((.(((((((((((.(((((((..((..(((((.((((......)))).((((((((.((((((((........(((....)))........))))).))).)).))))))......)))))..)))))))))......((((.((((((...((((((.(((......))).))).))).)))))).).))).((((((............))))))))))))))))).))))))).))))))).)).)).)))))((((.((......))))))..))))..(((((.(((((...........))))))))))...(((((....)))))(((((((..((((....(((..(.((((((((((((.((((.((((.........))))...)))).)))))))))))).)..).))))))...))))).))))))).)))))....))))).)))(((((((....(((.((((((.......)))...))))))....)))))))..((((....)))))))))))))((((((.......(((((...))))).......))))))...............)))))))))).)))))))))))))))))((((((....))).)))....(((((((((((((((..((((((..(((.(((....))).)))....((((((...(((((.((((((.((.((.(.(((((((...)))))))))).)).).))))).)))))....))))))((((((((.........(((......((((((.((((((((((..((..((((((.((((((((...((((.(.(...((((....((.((((....)))).))...))))).))))).(((((.(((.(((.(((((((((((.((((....)))).)))))))))))))).)))...))))).......))))))))))))))..))..........(((.........))).....)))))...((..((....))..)).(((.((((.(((((((((((.((((((((.(((........................(((((((........))).))))...(((((...))))).........((((...)))).))).)))))))).))))))))))).)))).))).((((((.....((((((((((((....))).)).)))))...)).....))))))))))).))))))....)))...))))))))..................))))))))))))(((((((((((.(((.......((((...((((((((((((.(((.(((((((((((.......(((((((..((((((((((.........(((((((....((((..((.(((((((((..(((....))).)))))))))...))...))))...)))))))((((((((((....)).)))))))))))))))..........(((((((.((.(((((..((((((...))).(((((....).))))......)))..))))).)).)))))))((((((............))))))....)))..)))))))..............))))))))))).))))))........((((((..(((((((....))))))).........((((((....))))))....))))))(((((.(((..(((((....(((..(((........))))))......(((((((((....))))))))).......))))).)))))))).))).)))))).))))..((.((((.....)))).))......))).))))))))))).......)))))))))......)))).)))..))))...
Thermodynamic Ensemble Prediction
.(((((((.((((...((({{..((((...(((((......)))))...}})),,....||...,.|||,.((((((.((((((((((((((((((.(((....,((((((.(((((((((((....,((((((.((..((|,|,,...{{{({(({{{{....,.)))))}))}..),)))},.,,,,)))))))).))).))))))|(((((((....)))))))}.(((((((......))).))))((((.(..((((..((((..(((((.(((...(((...(((((((((((.((({.(((((..((,.....(((((((,...,)))))))..},})..)))))..((((.,...,.)))).}))))))).))))))).)))...))).)))))..)))).))))..).))))....((((((.((,..(((.(((((,...(((((.(((((...(((,.((((.(((((.((...))))))).))))..}}){|.,|.{{((((((.((({(((((((.{(,.((.(((((.((((((((.........)))))))).))))).))......{(((((((((((..((.(((....})),))...)))......).)))))))))}.)))))))|,{((((,....,..,|||{.,{((...{||{{},,}..,)}},})))))),.......))).)))))))}||.||.{{,.,{({{((((((..((,({((((,{({.{{{|,,,|||{,{{{,(((((((((.(((((((.{((..(((({.{{((,,,,..,}}}.((((((((.((((((((,{,....,||,..,,||,....}}}})))))}})).)),})))))......)))))..},)))))))......(((,{((((((...((((((.(((......))).))).))).)))))).).))).((((((............))))))))))))))))).))))})),))))))).)).)),)))))}|{|.||.}},,,}))}||{{{{{|.{({,,({(,((,...,}.},}..}}))))))))},.(((((....)))))(((((((..((((....{((..(.((((((((((((.((((.((((.........))))...)))).)))))))))))).)..).))))))...))))).))))))).)))))..,.))))).))){((((((....(((.((((({.......)))...))))))....))))))}.{((((....)))))))))))))((((((.......(((((...))))).......)))))).....,,......,,)))))))))).))))))))))))))))){((({{....))).}}}....((((((((({(((((..((((((..(((.(((....))).))).,,{((((((...{((((.((((({.((.((.(.((((((,...|))))))}}).)).}.))))).)))))....))))))|{{(((((({{.......,|,.,,..({{{((,{(((((.((,..((..((((((.((((((((..,{{((.{...||((((....((.((((....)))).))...}})},..,,}|.((({(.(((.{((,(((((((((((.((((....)))).)))))))))))))).)))...))))).,.....))))))))))))))..))..)))))},.((|.........,,,....,}}|||,||||..,,....},..,|.(((.((((.(((((((((((.((((((((.(((.,,.....................(((((((........))),,)))...(((((...})))).........{{,,...)))).))).)))))))).))))))))))).)))).))).||||||.......(((((,{(((....))).}}.))))).,,)),..),)}}},}...}},)))))}..,.}|||||}}}))))}.......,.....,...,)))))))))))}(((((((((((.(((.......{(({...((({{(({{(((.(((.(((((((((((.......((((((,...|}||||,((,,{{{,...(((((((.{..((((..((.(((((((((..(((....))).)))))))))...))...}))).,.)))))))((((((((((....)).))))))))||||,||..,||.....{{{{({({(({((((({.|{{{{{..,,,,.((({....,||||,,......)))},}}},,....}}})))}||||||}},......,,.}})))).,},),,.,)))))))...,|.........))))))))))).))))))..,.,,..((((((..(((((((....))))))).........{||({,.,..,,))}},,..))))))((((({(((.,{{,{{{,,,(((,.(((........}}}}},...,.||||||||{{((((({{{{((.......)))))))))).|||}}.))).,})))),)))),.,,,||{|,}}}})))}})}......))).))))))))))).......)))))))))......}))).)))..))))...

Transcripts

ID Sequence Length GC content
AGUCUGUUGCCUUCCAGGGGCCAAGAGCUGCUCUGAUCACCCAGGGAUU… 2662 nt 0.5748
Summary

The protein encoded by this gene belongs to the P2X family of G-protein-coupled receptors. These proteins can form homo-and heterotimers and function as ATP-gated ion channels and mediate rapid and selective permeability to cations. This protein is primarily localized to smooth muscle where binds ATP and mediates synaptic transmission between neurons and from neurons to smooth muscle and may being responsible for sympathetic vasoconstriction in small arteries, arterioles and vas deferens. Mouse studies suggest that this receptor is essential for normal male reproductive function. This protein may also be involved in promoting apoptosis. [provided by RefSeq, Jun 2013]

Forensic Context

A study in mice demonstrated that spinal nerve ligation induced significant transcriptional changes in the injured dorsal root ganglia, including a 3.13-fold upregulation of the protein-coding gene P2rx1 [Wu et al. DOI: 10.1177/1744806916629048].