Basic Information

Symbol
P2RX3
RNA class
mRNA
Alias
Purinergic Receptor P2X 3 P2X3 P2X Purinoceptor 3 ATP Receptor Purinergic Receptor P2X, Ligand-Gated Ion Channel, 3 Purinergic Receptor P2X, Ligand Gated Ion Channel, 3 Purinergic Receptor P2X3 P2X Receptor, Subunit 3 Purinergic Receptor Purinoceptor P2X3
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Wound age identification

MANE select

Transcript ID
NM_002559.5
Sequence length
3792.0 nt
GC content
0.5282

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1353.90 kcal/mol
Thermodynamic ensemble
Free energy: -1420.37 kcal/mol
Frequency: 0.0000
Diversity: 999.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.((...)).)))...(((((..(((.(((.((((((....(((..(((..(((((.((((...((............))...)))).))))))))....)))(((((..((((((((.(((.(((.(((((((..(((((..(((((((((.(((.(((((.........(((.((.((((((((((....((((........((((((((((.((((((((((.....((((((.((((((((((((((..(((((((((..((((.........))))...))))))))).......((((.(((((.....(((((((((((((....)))))))))))))))))).))))))))))))))))...)).)))))).....)))))))))).))..((((((........))))))..))))))))))))....))).......))))))).)))))((((((((((((((((.....))))))(((..((((...))))..))).((((.((...((.((.((..((((..(((..((((((..(((..((((.(((((........))))).(((((.(((((....)))))))))).))))..)))..))))))..))).))))..)))).)))))))).((((....))))...((((((((...(((.(((...((...((.(((((((((.(((.....)))...))))))))).))...)).)))(((((((.(((.........)))..)))))))...((((....((((.....)))).....))))..))))))))))).....)))))))))).....(((((((((.(.((((((((((..((((......((((.(((((((....(((((...))))).....(((((((....(((((.......(((((((((((...((.((((.....(((((....))).))....))))....))...)))))))).)))(((((((((((.....(.(((((((((...((((.....(((((((..(((...(((((.((...((........)).))))))).)))....)))))))(((...)))....)))).))))))))).)...)))))))))))....)))))......))))).))........((((((((.(((((...(((.((((((.(((((..(((....(((((...........(((((((((((((((..(((.............)))......)))))))))))...))))....(((((.....(((((...........)).))).....))))).......))))).(((((((..((((.(((...))))))))))))))..(((((.....))))).....)))...))))).)))))).)))....)))))...))))))))...)))))))..))))((((((.((((((((((.((((.(((((...(((.(((((((...)))))))))).))))).)).......(((((((((((((((((((((.....(((((......)))))((((......)))).(((((.((((((.(((((((.(((((((....((((((((.(((((((((....((((.((((.(((..((((..(((((.(((........((.((((.(((((((.....))))...(((((.((((.(.((((((((..((((((((........(((((...........)))))..(((.((((((((.((.((((((.........))))))..)).)))))))))))....(((...))).)))))))..)..)))))))).))))).)))))...))).)))).))..........(((((.........(((((((((((((....((((((......))))))....)))(((((....((((.....))))...)))))....((((((..(((((......(((((.((((......))))......((((((..(((((...((((((((((((.....((.((((((((((.....)))))..................(((...)))))))).))....)))))))))))).....))))).)))))).......)))))))))).))))))))))))))))(((........))).........)))))...)))))))).))))......((((((.((((.(((...))).)))))))))).((((...))))((((.(((((..(((((((((.......))))....((.((((......)))).))...)))))))))).))))))).)))))))))))).)))))..))))))))...(((((((((.........(((((((........((..........))......)))))))...(((((((....)))))))((((((.((((.............))))))))))((((.......)))).....((((...((((...((((((((....))).(((.((..(((...(((.(((((.((....)).)))).).))))))..)))))(((((.(((((((....).))))))..)))))..(((((((((((...)))))))))))...)))))...))))..))))................)))))))))..........(((((........))))).....((((((((........))))))))................((((((((((...(((((.((((.....)))))))))....))))))))))...(((((...))))).....)))))))(((((....))))).......))).))))))).))))))))....)))...)))))))))..)))))))))...(((((((....((....))(((((((......(((((......))))).....)))))))))))))).................)).)))))))).)).))))))...))))..)))).))))).).).)))))))))......))))))))..)))))))))...))).))..))(((.(((((((..((((((((......(((((((((((.......((((.(((((((..((((((.(((((....(((((((....)))))))............((((((.(((((.....((((.(((((((...)))))))..........((.(((((...))))))))))))))))...)))))).....))))).))))))(((((((((.(.(((.((....)).)))).))))..)))))....))).))))..))))((((....)))).((((((..(((............))).)))))).....((((.(((..(((((....)))))..)))..))))..)))))))))))...))))))))..))))....))).))).........(((((.....(.(((((....))))).)....))))).(((((((...........)))))))..........))))).))).))).))))))))..).)))).....(((((.........((((((((.....................(((((...(((....)))...)))))))))))))........)))))...)))))).)))..)))........((((......)))).....)))))............................
Thermodynamic Ensemble Prediction
((({((,,{||,|||{.,{{{{(|,{{({{(({{.,|||.||,|||||{,,||(({{...((((((((((.((((...((((..((((......(((((((...((((.(.(((((.((((.(((((.(((((((((..........((.(((((..(((((({{,.......((((((,....,.}))))).,,..(((.....}}}.........,{((((((((..{..((((((.((((((((((((((.{(((((((((..((((.........))))...))))))))}}}.....{(((.(((((.....(((((((((((((....)))))))))))))))))).))))))))))))))))...)).))))))..,..)))))))))),((((((((((........)))))).)))).{(((((((({{{{{{.,,{({{{{(.(((({....((((((((({((((((.....)))))).....((({...)))),,))))))))}.))))).))),))),|}.,.....}}|||||}.}}})})))}))))))..))))).)).(({,(.((((((((((((({{((((.(((((..(((.((........))..)))..))).)).))))))))).((((....))))...(((((({....,...((({{{((...((.(((((((((.(((,...,)))...))))))))).))...)}...}))))))((((,((((....}))).))))..)))))).}))).})))).))))..(((.((.((((.(((((((........))).),,))...)))).)),))}.)))))))))))))))))).))))).))))).))))))).....{((({...})))}.....))))))))...))))........,{,((((((.(((({{,((((.((((((({({{,.,,,.,..,,})}}....{{{.{{{{{{,|||{|||{{(({(((({,.,,,.,}|||||||||,,.||||}....(((((((..(((...(((((.({...((........)).)}))))).)))....)))))))|||||||||..,,||},,}}}||||||{|...,|||||||,||...,,,,...}}.,,|||}|.,,,,,,,,.||,.|||||(((((({,.({{.{(,{{((((((((..((((,.....)))}...)))))))}.,|,,||.|}})})))))).))}..,},.,))}.,},.,},))}))})))))}.))).....((,,....,,))))))))).)))|...||)))))))))))|.{({,,((.(((((((((((..((((.(((...)))))))))))))).{((....))}((((({,.....,))))))..,,((((({{{(((.((((((((..,....{,||,..,(({,,(((((.((((,.{(((,((((((,(((({((,,....{{(((((((({...})))))}.}||,{((.((((......))))}}}},..,{{{|{{|||||{{{(((((.,....,,|,{((({......))))}.,.....,},))}))}}}},,,.}}))))|{{{{((...))))))},,||}||,...}})}|,,|}|}}}}}}...{(((,{{(,{,.....,..(({(.|||((((.....))))...(((((.((({{(.((((((((..{(((((((.,,,,...,.,,,|,......,,,||,|||{(((.((((((((.((,((((((.........)))))}..}}.)))))))),},,}}}|||.|,|||.})}}})),.),.)))))))).))))).)))))...)))}}}}},,)}.,}}}....,)))}..}}}},{{((,((,,,,(((((({{(((((({{..{{||||||{.{,.,,(((((..{.((((.....))))}..)))))...,((({(({{((,,,.{,{..,,,,,.|||,....,,)))).,|||.((((((..(((((...((((((((((((.....((.((((({((((.....))))}..,,....},.....,..{{{,,.,}}))))).)}....)))))))))))).....))))).))))))....,,,||||||||},.},,}})})))))))))||{........{{{{........)))).,{{{....{{{||||{,...}}||||||,,,{|}|{|...)),}))))))))))}))))...,,))}))))),,,,)))))}|((((.......)))),..}}}}}..),,)))))))).)))))))))),))....)))))))))).,.)))))))))),,.(((((.,..((((((((((((.,((((((....)))))}...,.)))))..........)))))))..,))))).(((((((....)))))))((((({{((((..,.......}..))))))))))((((.......)))).....((((...((((...((((((((....))),{((.((..(({..,(((.(((((.((....)).)))).).))))))..)))))|((((.(((((({....}.))))))..))))}.,(((((((((((...))))))))))),..)))))...))))..)))),,,}.,,,.,,,,,))))))},}}|||,.......(((((........))))).....((((((((........))))))))...,,.,{{{{|,...}|||,.{||||..,{((((((((,,,.{{,(((((((((((.,,.,.(((((({({{({..,}}}},..{((((((((((((((((((((((((((((((.((((((((((((((((((((..((((((..((,...}))..)))))).....(((((((.,,,{,..,,),(((((((.....,(((((......))))).....))))))))))))))..................)))))))).))))((((((.........((((((,.,{......}))))))).......(((((((....)))))))....))))))(({{((((((.{,.....,....,,..})))))))),|..,.}}.,,..{{|,.(((((((..((((((((((((.....)))))).{((((((.,({.{((((({{....}}))))))).)).))))))}(((((((...)))))))))))))..)))))))))),..(((,...,,))},...{(((((((.{({.....))).))))).))}..}))))}.(({(,{{{{|,.....,))))..,))).))..)))))).))))...).))))))))))){{{{{|,,{{,...,|,..,,}}}}),)}})))||}|,|{(({(({,,{||{{,,{{||}|,..,,},|}}}}...||||,|{||{.{{{,{({{,.....,,,........,,,}},|||||,|{(({{..,,.(((((....))))).)}}}},,.))}|||||{|}}}}}}}}},.}},}}},.......}))))))))..}}),,..)))))))).}....))))))))))).........((((((((.....................(((((...{({....})}...))))))))))))).......,(((((,,,{{{.|||,,...,,))},}),)}||||...,..),,}...}})))))}...........,,....}},,,,,...

Transcripts

ID Sequence Length GC content
GGCCUCUUGGAAGCCAGAGUAUCAAGAGCAGAGAAUCUCACUAGGAUUG… 3792 nt 0.5282
Summary

This gene encodes a member of the P2X purinergic receptor (purinoceptor) gene family which includes seven members (P2RX1 - P2RX7). P2X purinoceptors are a family of cation-permeable, ligand-gated ion channels that open in response to the binding of extracellular adenosine 5'-triphosphate (ATP). The encoded protein is a subunit of the trimeric P2X3 receptor ion channel which is expressed by sensory or autonomic neurons. A deficiency of the orthologous protein in mice is associated with reduced pain-related behavior and urinary bladder hyporeflexia. [provided by RefSeq, Aug 2017]

Forensic Context

A study in mice demonstrated that the P2RX3 gene, encoding a P2X3 receptor for ATP, was downregulated in the primary somatosensory cortex in both burn injury and formalin-induced inflammatory pain models one hour post-injury [Erdei et al. DOI:10.3390/ijms26083538].