Basic Information

Symbol
P2RY13
RNA class
mRNA
Alias
Purinergic Receptor P2Y13 P2Y13 FKSG77 GPR86 GPR94 Purinergic Receptor P2Y, G-Protein Coupled, 13 G Protein-Coupled Receptor 86 G-Protein Coupled Receptor 94 P2Y Purinoceptor 13 G-Protein Coupled Receptor 86 GPCR1 SP174
Location (GRCh38)
Forensic tag(s)
Forensic psychiatry evaluation

MANE select

Transcript ID
NM_176894.3
Sequence length
2765.0 nt
GC content
0.3913

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-654.87 kcal/mol
Thermodynamic ensemble
Free energy: -710.49 kcal/mol
Frequency: 0.0000
Diversity: 659.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((((.((..............((((.....((.(((((((......((..(((.....)))..))...((((((((((((((((.((..((..(((((.((((.(((........((((((...((((((((.(..(((....(((((.....)))))...)))..)))))....))))....))))))))).))))..)))))..))..))))))))))))........(((.((..(((((..........................)))))..)).)))...((((...))))))))))..........))))))).))......))))....(((((((.(((((.....(((....((((......((((((((((((((.(((((.((.....((((.(((((((((((((((...)))).)))))))....(((((((((...(((((((((((((((((((((....)))))..))))))).))))...)))))...........((((......((.....)).......)))).....)))))))))....(((((((((.(((..((......))....)))))))))))).((((((.((((((.(.((((((((........((((((..(((((.......(((((((.((((((..((((((............(..(((((((.((.((....)).)).)))))))..)..)))))))))))))))))))((((((..(..((((((((..(((.........))).))))))))..)..))))))....)))))..))))))))))))))...).)))))).((((((((.(((((((((...............))))))).)).............((((..((((((((((........))))).....)))))..))))..))))))))))))))....((((((....)))))).....((((((((..((((.(((.((.(((.((((.((((....(((.......(((((((.((((((((..(((((....................)))))..(((((((((((((....(((((((((((.(((.......))).))))).))))))...........((((..........))))...(((((........)))))....))))).))))))))...(((((......)))))..(((......))).((((((.....)))))).((((....((((.((((((((((((.(((.(((((((......))))))).............((((((((((((((((....((((((((............(((.(((((((((.....(((((..................................)))))....))))))))).)))..............))))))))............(((......)))))))))))))))))))..((((((((((.(((((((((.((...((((.(.....).))))...)).))))..))))).)))))).)).)).(((((.((((((((((((.((.(((((((((((......))))))))................(((((...(((((((((..(((..(((((.....((((...(((((.................)))))...))))....)))))..)))..)))))))))..)))))..............(((....))).((((((...............((.(((((......((((.((....))...))))......)))))))..(((((((.....((..(((((..........(((((...........)))))))))).))))))))).(((((((((((.((..........................))))))))..(((...........)))....))))))))))).(((((((......)))))))............((((..........)))).....((((.((.(((((.....)))))...)).))))....))).))..))))))))))))..)))))..(((((...((((((....)))))).))))))))..)))).)))))))).))))...))))..................)))))))).............(((((((((((((((.((((((((((((.(((....((((((..............((.((.(((.(((((.(((....)))...)))))..)))))..))..(((.((((...)))))))...........(((((...)))))))))))...(((.........))).........))))).))))))))))....(((.(((((((....))))))).)))....)))))))))..)))))).....)))))))........)))...)))).)))).))).)).))).)).))........))))))))....)))).))))...)).)))))))))))))))))))(((........)))..........)))).....)))......)))))...)))))))))))))))(((((((((.......(((((((.......((...((..(((((((((.(((((...........)).))).))))...)))))..))...))......)))))))........)))))))))......
Thermodynamic Ensemble Prediction
.......,(({((.,,..,....,...|||((({...,.{(.(((((((....,{((..(((.....}))..)}...(((((({{((({((((((((.(,..{((((.((((.(((.....,,,((((((.{(((((((((.(..(((....(((((.....)))))...)))..)))))..}}))},}...))))))))).)))}..)))}},,.)}})}}|}|}}}}},.,,||,..|({.((..(((((..........................)))))..)),}})...,|||...})))))))))..........))))))).)),.....))))....(((((((.(((((.....({({{..({{{......((((((((((((((.(((((.((,{(..((((,,({{(((((((((((...)))))}})))))....(((((((((...((({{{((((((({,,,{({{.,.,||},,..}|})))}.,)))},.))))).,,........((((......{(.....}}.......)))).....)))))))))....(((((((({,(((..({.....,))....)))))))))))).((((({.((((((.(.((((((((........((((((..(((((.......{((((((.((((((.,{{,,({,...{{{({{.,{{{((,((({.,,.,|}}}.,,,))))))},))}....}}))),))))))))))))|((((((..(..((((((((..(((......,..})).))))))))..)..)))))),...)))))..))))))))))))))...).)))))).((((((((.{,(((((((...............))))))).),.............{(((..((((((((((........},)))}}}}})),}}..}}}}..)))))))),)))))....((((((....)))))).....{(((((((,.{(((.(((.((.(((.((((.((({...,((({......({(((((,{{,,{{{{..((({(.,.|,.........,,,.,,)))}}..{{|{(((({((({|,..,(({{{,,,{,|{{{,{,.,{{|||{|||,|||||||}.......,...((((..........))))...,{{{{...,.,,.}}}}}....}}}}}.)))))})),..,{{{{......,}},,...}},,,,,.,}}}||{(({.....}}}))},{(((....((((.((((((((((((.,,{.(((((((......))))))).............,{{{(((((((((((..,{{{,,{,({{,.,,,{{{{,,.{{{.(((((((((.....(((((..{,..............................)))))....))))))))).,,,.{(((,{.,.,..,,|,,,.}}}}.....,}}}.))})}.))))},)))))))))))))))}..((((((((((.(((((((((.((...((((.(.....).))))...)).))))..))))).)))))).)).)).(((((.((((((((((((.((.(((((((((((......))))))))................{{{((,,,(({{({(((..,{{..{{{{{...|||||{|..{{({{........,,,,.....})))),..}}}}..)}))))}..}}}..})))))))}..|||||{{{{{{{{,,..,,(((....,.,.,,,{{{.,,.......}},,,.}}|||||...,,,((({.,,....}}...})))....,|}|}|}....(((((((.....((,.(((((..........{{,,,...........)),,,))))).),))))))),{((({((((((.((.........{{{....}},.......)))))))}..(({...........)))...,)))))},,,||.(((((((.....,})))))).}}.........((({....,,,...)))),...,|{{{.,,.,,,((,{{..}})))},.,,.))}}....))).))..))))))))))))..)))))..(((((...((((((....)))))).)))))}}}..)))).)))))))).}))}...)))),,,}}}}}}}}},,....}})))}},|||,,.|{.....(((((((((((((((.(((((((((((({(({..,,{,.{||.............|(({({,{{,.(((((,((,....})}.,.)))))..,,,{{({...,|||.((((...}))),,}...,,.,,...(((({..,|||}}.|||},...{{|..,,,,,..))),....,,,,},))).))))))))))....(((.(((((((....))))))).)))....)))))))))..)))))}...,.})))))}........}}}...)))).)))).))).)).))).)).}).}}.....))))))))...,})))})}}))}.)).)))))))))))))))))))(((........))}..........}})}.....)))......)))))...))))))),,,,|||,(((((((((,{,,...(((((((.{,,,..{{.,,((..{{{{{((((.(((((..,........}}.))).)))}...))))),,}),..}}..,}..)))))))..,,,,..))))))))).,,,..

Transcripts

ID Sequence Length GC content
GCUCAUUUGUAGGCUGAACUAAUGACUGCCGCCAUAAGAAGACAGAGAG… 2765 nt 0.3913
Summary

The product of this gene belongs to the family of G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor is activated by ADP. [provided by RefSeq, Sep 2008]

Forensic Context

A study in humans analyzing gene expression profiles from atherosclerotic lesions and type 2 diabetes mellitus patients identified the P2RY13 as a shared hub gene with robust predictive performance in machine learning models, implicating it in cholesterol transport and inflammatory signaling [Wu et al. DOI:10.3390/ijms27010136]. Separately, a human postmortem brain study found the P2RY13 was the gene most highly correlated with prefrontal expression of LINC01268, a long non-coding RNA specifically associated with suicide by violent means and aggressive behavior, within a co-expression network enriched for immune response functions [Punzi et al. DOI:10.1101/257188].