Basic Information

Symbol
P3H4
RNA class
mRNA
Alias
Prolyl 3-Hydroxylase Family Member 4 (Inactive) SC65 LEPREL4 NO55 Prolyl 3-Hydroxylase Family Member 4 (Non-Enzymatic) Endoplasmic Reticulum Protein SC65 Synaptonemal Complex Protein SC65 Nucleolar Autoantigen (55kD) Nucleolar Autoantigen No55 Synaptonemal Complex 65 Leprecan-Like Protein 4 Leprecan-Like 4 NOL55 Prolyl 3-Hydroxylase Family Member 4 Rat Synaptonemal Complex Protein Nucleolar Autoantigen, 55kDa
Location (GRCh38)
Forensic tag(s)
Wound age identification

MANE select

Transcript ID
NM_006455.3
Sequence length
2352.0 nt
GC content
0.6114

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1029.40 kcal/mol
Thermodynamic ensemble
Free energy: -1070.67 kcal/mol
Frequency: 0.0000
Diversity: 684.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((...(((((((((((.((((.((((((((.((((.((.(.(((((((((.((((((((((((((((((((.(((.((((((.((.((((.....)))).)))))))).))).))).((.(((..(((((((((((.....))))))).))))....))).)))))))..((..(.((.(((((((.((.((..((((((((.((....)).))))).))).)))).))))))))).).))...(((.(((.....))).))))))))))))))))))))))))).)))))).)))))...))).((..((((.(((......)))))))..)).)))))))))))))))..((((((((.(((..(((((......)))))))).))...)))))).(((.(((((((((((((.((.((.(((.((((..((((((.(.((.(((.((.((.(((((((..((((.((((((..((((((.(((((((.((....((..((((((((((.(..(((....)))..).)))).)))))).))...........((.((.(((..(((.(((((((............))))))))))..)))))))....(((((((((((.((..(((((((.(((((...)))((((((.((((((.(((((((((((((........)))).))))....))))).)))))))))))).)))))))))(((((.(((((.((((.....)))).)))))))))).))))))).)))))))).))))))))))....(((((....(((((((((((...((((.((((((((((..((....))..))))))).)))))))..)))).......((((((...)))).))((((...))))........(((((((((..((((((((......)))..(((((((.((((((.((((((((((.((((((((((.((..((((((((((((((((((((((..((((..((((.((((((.......(((((.((((...)))))))))...(((((((.(((((((.((((((.......))))))))))))).(((.(((..((((((.(((...(((...((.(..((((((((.((((.(((.......))))).)).))))))))..).))......)))...))).)))).)).....)))))).)))))))(((....)))...))))))...))))..))))..............))))))))))))....).)))))))).)..)).))......((((((..(.(((((.(((...(((((.((.....(..((.((((..((((...))))......)))).))..)....))))))))))..))))))))))))...))))))))))).))...........)))))...)))))))).)))))..))))))))))).)))((((....((((((....)))))).....)))))))))))...)))))(((((((.(((...)))...)))))))........(((((....))))).................))).)))))))))))))))))))))))).)))))))......))..)))).))).))))....))....)))))))))))...))).(((((((.(((.((.((((....)))).)))))((((((...(((.((((..((((.....................(((...(((.((((.....)))))))...)))......((((((....(((((((.(((((((.(((...)))...)))))))..)).)))))....)).)))).....................(((.((((((((.(((......))).))))).)))..))).))))..)))))))..))))))((((((((..(((((((.((((....)).))))))))))))).))))((((.....(((.((..(((((((......................))))))).....)).)))(((((((.(((..(((.(((..((((((.(((.....)))))))))..(((((((.((..(((.(((.....)))))))).)))))))((((......)))))))))).))))))))))))))...)))))))))))))......(((((....(((((.....)))))..)))))(((((((..(((.((((..((......)).)))).)))..((((((((((..((.(((((((((...))))))))).)).)))))))))).)))))))....(((((((.......)))))))....
Thermodynamic Ensemble Prediction
.,,(((((.((((,,(((((((((((((((((((.,(((((({({,((((((.((((((((((((((((((((((.(((.((((((.((.((((.....)))).)))))))).))).))).((.(((..(((((((((((.....))))))).))))....))).))))))))}.,.(({{{.{{((,{({((,...}||}|||||{(({{{{||{||,||{||{{{|||,|||||||||,|{|,...(((.(((.....))).}}},.,||||}|||||||||||,,|{|(({,..}})))....)).})),)))))))}}}.,)}))})))}})),,)))))))),},,,||{.((((((((.(((,.{((((......)))))))).))...)))))).))}}|||||}})))}}},}}.}}})))))})))))},)))))).}},,,|,|}|}}|||||||..,,{({(,,{||..,,.|||}|||||,,.||}}..}|}}((((((((((.{,.(((....)))..).))))}}))))).{{..,||..|{{.{{.|||(((.,(({{(((((((..,,.......,)))))))))).,)))}}}}..{.(((((((((((.((..(((((((.(((({...}))((((({{((((((.(((((({{{{{{{......|,|||}.,}))}}}.))))).)))))))))))).)))))))))(((((.(((((.((((,...,)))).)))))))))).)))))))},))))),}.|||||}||||{,..((,,{||..||||||,((((...((((.((((((((((..((....))..))))))).)))))))..)))).....{.{{{,|,,.,|||{(((((((...,,,,....,...))))))))).,||.,,.{{,,({((({(({(((({{{.,,{{{{...{,{(({(({((((((({(((({,,((((((((((((((((((((((..((((..((((.((((((,{,,.{{({{{|,|{||,,.,}}}|||||{..(((((((.(((((({{((((((.......))))))))))))).(((.(((..((((((.(((...(((...({.{..((((((((.((((.(((......,))))).)).))))))))..}.,).,,...)))...))).)))).)).....)))))).))))))),||..},),}...})))))...))))..))))..{,....}}.,..)))))))))))).)},,.,})))))).},,||.||..,...,{{(((.,(,({{({.(((,..{{{{{,||}|,..|}}||.|{{{..((((...))))...,,,)))}.))}}))}.}))))))))))..)}}}}|||||}},,,|}||||||||,,},.,.....,,,,||,,,...,,}))}}},)))})}))})}}))))}..,,|((((,...(((((,....})))))...,.))))))))))|||,}}}},(((((((.(({...}))...)))))))....,,,,(((((....))))).................,,),}|||||||||||||||||||||....({(((((........))))).)))))).....))))},{{|||,}},.,}..})))}(((((........}}}})}))}})))))})|||{((({{...|||.||(({{((((.,{{{...........,,,|,{(((,(((,.,,||}}},.,))))))...,||||{,,|{{{{{{||{.{{,{({,,((({((({((({,.,||,,{||||||,...,.||||,...,|}|}|,,...,.................|||}}}}.}}}),{{.,,.{{{{{{{{,.,,.{.((((({((({,..|||((((..||}}}}{(((((((..(((((((.((((....)).))))))))))))).))))|||.,.|||{((,|{..(((((((..,................,,.)))))))....,)).,}}|{,|||||{||}}|||}||,..((((((.(((.....)))))))))..{((((((.(({,,{(.(((.....)))))))).)))))))||||}}}},})),}))))},.)))))))),)}})))}})))))))))}}}}|}}.}}||({{..{.{((((.....)))))}})))}},|}}}))})))))}}}}})}|,}}}}}))}).))}))},.((((((((((..((.(((((((((...))))))))).)),)))))))))){||,,,.)))}}||{({{{.....,,)))))))....

Transcripts

ID Sequence Length GC content
AGCUCAGCUCCGGAGAGCCGGCGGCGCGGCGGGCAUGGCUCGGGUGGCG… 2352 nt 0.6114
Summary

This nucleolar protein was first characterized because it was an autoantigen in cases on interstitial cystitis. The protein, with a predicted molecular weight of 50 kDa, appears to be localized in the particulate compartment of the interphase nucleolus, with a distribution distinct from that of nucleolar protein B23. During mitosis it is associated with chromosomes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in Sprague-Dawley rats demonstrated that the mRNA expression of the P3H4 showed statistically significant changes at 4, 8, and 16 hours post-contusion injury compared to control, and its expression pattern, combined with eight other mRNAs, was used to train a stacking ensemble machine learning model for wound age estimation [Dang et al. DOI:10.3390/diagnostics13030395].