Basic Information

Symbol
P4HB
RNA class
mRNA
Alias
Prolyl 4-Hydroxylase Subunit Beta PDIA1 PDI P4Hbeta ERBA2L PROHB PO4HB PO4DB DSI GIT Procollagen-Proline, 2-Oxoglutarate 4-Dioxygenase (Proline 4-Hydroxylase), Beta Polypeptide Protein Disulfide Isomerase Family A, Member 1 Protein Disulfide Isomerase-Associated 1 Cellular Thyroid Hormone-Binding Protein Prolyl 4-Hydroxylase, Beta Polypeptide Collagen Prolyl 4-Hydroxylase Beta Protein Disulfide-Isomerase EC 5.3.4.1 P55 Procollagen-Proline, 2-Oxoglutarate 4-Dioxygenase (Proline 4-Hydroxylase), Beta Polypeptide (Protein Disulfide Isomerase; Thyroid Hormone Binding Protein P55) Procollagen-Proline, 2-Oxoglutarate 4-Dioxygenase (Proline 4-Hydroxylase), Beta Polypeptide (Protein Disulfide Isomerase-Associated 1) Protein Disulfide Isomerase/Oxidoreductase Glutathione-Insulin Transhydrogenase Thyroid Hormone-Binding Protein P55 Testicular Secretory Protein Li 32 Protocollagen Hydroxylase CLCRP1 PHDB
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000918.4
Sequence length
2437.0 nt
GC content
0.5724

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-935.10 kcal/mol
Thermodynamic ensemble
Free energy: -981.38 kcal/mol
Frequency: 0.0000
Diversity: 627.23
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((...(((...(((((..(((.(((((........))))))))......(((((((......(((((((.(((((((((((.(((((((.((((((((((.((.((((((((.((((.(((.((((.(((((...)))))..((((.......)))).)))).))).)))).)))))((((((.(((....))).)))).))....))).))..)).)))))))).))..((((.((((..........)))).)))).((.((((.((.........)).)))).))..))))).(((((.(((((((.((.....)).)))).))))))))))))))...)))))))))))).......(((((..(.....)..).)))).))))))).((((.....))))...))))).))).))))((((((((...(((((..(((.(((((.(.((.((((((((..((((..........(((....)))((.(((((((((..(((((((((((((...((((.(((((....))))).))))...(((.....))))))))))))))))....))))))).)).))(((((((((((((((((....((((((((.(((.(((....).)).))).)).))))))..(((((....(((((.(((....)))))))).....(((((((((((.((((.....((((...((........))..))))......)))).)))))))))))......))))).....))))))))).......((((((.(((..(((((....)))))..((((.........))))...)))))))))((((((((((((((....(((..((..(((..((((((............(((........))).....((((((..((((..((..(((((...(((.(((((((((.....((((..(.(((...(((((((.((((...((..((....((((..((.(((.(.((((.((......)).)))).)))).))..))))..((((...((((.(((((.(..(((((((............)))))))..)))))))))).))))...........))..))...).))))))))))...))))..))))((((((((.(((....)))))))))))(((.((((((((((((((((...((((......))))...))))))))..))))))))...)))...))))))))).)))....(((((...((((....))))..))))).((((((.((((((((.((.(((((.(.((((((((.((..(((((.(((.(((........))).))).)))))..((((.............))))...(((((.((((((((.((((..(((((...((.((((...((.(((.(......).)))..))...))))))...)))))..).))).))).))))).))))).)).)))))))).).))))).)).)))...(((((((((((((..((((..((..(((((((.((..(((....)))....................(((..(((.......)))..)))((((....))))((((((((.......))))).(((.((((((((....(..(((....)))..)..))).))))))))........((((((...))))))..((((....)))))))....)).))))..)))..))..)))).)))).))))))))).((((((.(((((.((.(((....(((((........)))))..))).)).))))).))))))....)))))))))))....)))))..))..))).)..))))))(((((((((..(((((.(((.(((((((((((((((((((((((((....((((((((((((......))))))))))))............(((((((.........)))))))..(((...))).)))))))))..))))....)))))))))).))))).))))))))))))))..))))))...)))..))..)))(((((((....)))))))....))))))))))))))..(((..(....)..))).((((.((((...((((((.(.(((.((((((((..(((((.........((((((((((....))).))))...))).........))))).)))))))).))).).))))))..)))).))))...))))))))...))))..)))))))))).).))).)).)))...))))).(((((.(((((.....))))).....)))))((((((((((((..((((...)))))))))))...)))))(((...(((......)))..)))..))))))))...................
Thermodynamic Ensemble Prediction
{{({((,,,(((.,,(((({..|||,||{|{.....,.,))}|||||||,{..(((((((......((((((((((({{((((((.(((((((.((((((((((.((.((,(((((.((((.(((.((((.(((((...}))))..|{{(,,.....}))).)))).))).)))).))))){{((((.(((....))).)))).}}....,)).))..)).)))))))).))..((((.((((..........)))).)))).((.((((.((.........)).)))).))..))))).(((({,(((((((.((.....)).)))).))))))))))))))...})))})))))))..,,...{,,,,..{,,,,.,.,)}}))).))))))).{(((.....)))}...,}}||{|,,{||||(((({,((...,{((({{(({{(({{,.,,||,(({((({,.(({{{...,,.,}||||{{{.,{{.(({((((,,,,({.,(((((((((((({{{{{(({((((({{{{|||||{||},.,{{{(,....}}))},))|||||.,|{{|...}))),))))).|||||||.,{|||||||...,{{((((((.(((.{{{....).)).})|.|},}}}}}}.,(({(((......,.}|)||||}(((((((({{{,.(((({.{{..,..}||,,}..}}}}}}}))))},},,,))..||,},,)}}}))))})))))))))..,,...))))))),)}.})))),)})}}}}},.((((((.({({{(((((....|)))).,((((.........))))...||}))))}}((((((((((((((,...(((..((..(((..{(((((............||||||,|||,}}}|,..|({|,,{.,{|||,,|.,,{{{,,.{.(((.(((((((((,....((((..{.((({{.((((((((((({{.....|{{..,.|{{|.,(({,(({(.,,(({((..{{{.,..}))).))))},,..))))..|||{...,{{{.(((({.{..(((((((............)))))))..})))))))||.((((........))))..}}}...,.)))))))))).,,}))),,))))((((((({,(((....)))))))))))(((.((((((((((((((((...((((......))))...))))))))..})))))))...)))..,))))))))).))),...(((((...((((....))))..))))){((,((({,{,{,(((.((.(((((.{.((((((((.((..(((((.(((.(((.,....,.))).))).)))))..{{{,....)))}{{{{.,.,,...(((((.((((((((.((((..(((((...((.((((...((.(((.(......).)))..))...))))))...)))))..).))).)))},)))).))))).)),)))))))),),))))).)).))).({(((((((((((({..((((..((.,({,((((.((..{(,....||||,...,.,....|{,.....{{{..(((.......))),,|}|{({{..,,}}}}|||(((((.......))))).(((.((((((((....{..(((....)))..}..)))))})))))).||...,,((((((...))))))..((((....))))..,....,,.)))).,))}.,)),,)))).))))}})))))))))((((((.(((((,((.{((..,.(((((........)))))})))}})).))))).)))))).,.{||||,,,,,,}.},}))}})))),))),|,|||)}})}}(((((((((,.{((((.(((.({(((((((((((((((((((((((....((((((((((((,....,))))))))))))............,((((((.........))))))}..{({...}}}.))))))))),.}})),...)))))))))).),))).))))))))))))))..))))))...))).,))..)))(((((((....)))))))...,)))))))))))))}..(((..{..,.)..))).((((.((((...((((((.{.(((.((((((((..(((((...,,....((((((((((....))).))))}..,}},........))))).)))))))).))).).))))))..)))).)))),,.})))))))}}.))))..||||,}})))}},}|||||{},}...,,}},.}}}}}}|,,,|}}}}})))}}.{((((({{(((((((((((((..((((...)))))))))))...))))))},...{((......}}}.,),...,.))))))}...,,,,,.....,,,,.

Transcripts

ID Sequence Length GC content
GCUCUCGUCGCCCCCGCUGUCCCGGCGGCGCCAACCGAAGCGCCCCGCC… 2437 nt 0.5724
Summary

This gene encodes the beta subunit of prolyl 4-hydroxylase, a highly abundant multifunctional enzyme that belongs to the protein disulfide isomerase family. When present as a tetramer consisting of two alpha and two beta subunits, this enzyme is involved in hydroxylation of prolyl residues in preprocollagen. This enzyme is also a disulfide isomerase containing two thioredoxin domains that catalyze the formation, breakage and rearrangement of disulfide bonds. Other known functions include its ability to act as a chaperone that inhibits aggregation of misfolded proteins in a concentration-dependent manner, its ability to bind thyroid hormone, its role in both the influx and efflux of S-nitrosothiol-bound nitric oxide, and its function as a subunit of the microsomal triglyceride transfer protein complex. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.