| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCAUCCCUCUGGCUCCAGAGCUCAGAGCCACCCACAGCCGCAGCCAUG… | 926 nt | 0.5767 | |
| AGCAUCCCUCUGGCUCCAGAGCUCAGAGCCACCCACAGCCGCAGCCAUG… | 1021 nt | 0.5808 | |
| AGCAUCCCUCUGGCUCCAGAGCUCAGAGCCACCCACAGCCGCAGCCAUG… | 992 nt | 0.5776 |
This gene is a member of the kernel lipocalin superfamily whose members share relatively low sequence similarity but have highly conserved exon/intron structure and three-dimensional protein folding. Most lipocalins are clustered on the long arm of chromosome 9. The encoded glycoprotein has been previously referred to as pregnancy-associated endometrial alpha-2-globulin, placental protein 14, and glycodelin , but has been officially named progestagen-associated endometrial protein. Three distinct forms, with identical protein backbones but different glycosylation profiles, are found in amniotic fluid, follicular fluid and seminal plasma of the reproductive system. These glycoproteins have distinct and essential roles in regulating a uterine environment suitable for pregnancy and in the timing and occurrence of the appropriate sequence of events in the fertilization process. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
A study in humans demonstrated that PAEP is a highly specific mRNA marker for menstrual blood, showing no amplification in peripheral blood, saliva, semen, or vaginal fluid [Akutsu et al. DOI:10.1007/s00414-024-03199-y]. Research confirmed its expression is exclusive to menstrual blood with high expression levels and robustness, remaining detectable in dry stains at room temperature for up to 180 days and under wet storage conditions, outperforming other markers like LAPR3 and MMP7 [Liang et al. DOI:XXX]. Furthermore, transcriptome sequencing of forensic body fluids confirmed PAEP as a novel absolute specific marker for menstrual blood, highlighting its potential for body fluid identification [Liu et al. DOI:10.1007/s00414-023-03131-w].