Basic Information

Symbol
PAFAH1B1
RNA class
mRNA
Alias
Platelet Activating Factor Acetylhydrolase 1b Regulatory Subunit 1 LIS1 PAFAH NudF MDCR MDS Platelet-Activating Factor Acetylhydrolase 1b, Regulatory Subunit 1 (45kDa) Platelet-Activating Factor Acetylhydrolase IB Subunit Beta Platelet-Activating Factor Acetylhydrolase, Isoform Ib, Alpha Subunit (45kD) Platelet-Activating Factor Acetylhydrolase, Isoform Ib, Alpha Subunit 45kDa Platelet-Activating Factor Acetylhydrolase, Isoform Ib, Subunit 1 (45kDa) Miller-Dieker Syndrome Chromosome Region PAF Acetylhydrolase 45 KDa Subunit Lissencephaly 1 Protein Lissencephaly-1 Protein PAF-AH 45 KDa Subunit Lissencephaly-1 PAF-AH Alpha PAFAH Alpha PAFAHA LIS-1 LIS2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000430.4
Sequence length
5589.0 nt
GC content
0.4205

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1583.60 kcal/mol
Thermodynamic ensemble
Free energy: -1702.78 kcal/mol
Frequency: 0.0000
Diversity: 1399.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((..(((((((((.((((((((((((((((.(...(((((..(((((.(.(((.(((.(.(.((((((((.(((...(.((.((((.(((((.(.(..((((..((((((((((((((((.(((..(((........)))..))))))))).(((.(((.((((.......))))...))).)))...)))))))))).))))))))))).)))))).)......)))))..))))))).))))))).))))))(((.((((((((((((((((.....................)).))).))))).)))))).))).(((((..(.(((((((.((((((.((((((((((.(((((((.((((.(....(((((.((..((((...))))..))))))).....).)))).))))..))))).((((.....))))...(((((.(((.......))).).)))).((((((((....))))))))((((......))))....(((((......(((..(((.(((((((.((((...((((((((.......((((((((..(((.....((((..((....)).)))).((((((((((.(((.((......)).)))(((((((((((.....)))))))))))......))))))))))..(((((....(((((((...((((((((.........(..((((((....((((((...........((((....((((........))))))))...........))))))...))))))..).(((((........))))).)))))))).(((((((.((((...............((((((((.((((..(((.(((((((.(((((((....(((((.((((......(((.((...((((((((((((((((((......)))...(((.((((.((((((.((((((.((((((........))))))....(((((...)))))(((((.....(((((.((((((((.....))).((.(((((((....(((...(((((((..((.((((((.((((((((((((..(((..((((.((((.(((....((......))...))).))))...)).))..))).))))..)))))))).))))))(((((..(((.((((((...(((((....)))))..........(((((((.(.((((((....)))))).)...(((((.....((((.....)))).((((........)))).))))).))))))).))))))..))).)))))........))..))))))))))....))))).)).))(((.(((((...)))).).)))..))))).)))))....)))))..))))))....)))))).)))).))))))))))))....((((((.((((....((.((((((........)))))).))...)))))))))))))))))).)))....(((.((((((...(((.(((..(((((((((((((((((....))))))))......))))))))).))).))))))))))))))))))))).....)))))))...)))).......)))))).((.((((.(...............).)))).))..))))))))))))(((((((.(((((((..((.....))....(((...(((((((.....)))))))..)))(((.((..(((....((.(((((.(.(((((.((((..(..........)..))))..))))).)..))))).))...)))..)).)))........((((.....))))(((((((.(((((.........(((((..................)))))))))).))))))).............))))))).))))))))))).)))))))....)))))))....)))))))).))))))))...))))))))..)))).......((((((((.((((((((((((((.((........((((((((((...)))))((((((((((.(((((((..((((((..((((((((.(((((((((((..((.((((.((((.(((((....((((((.(((((...)))))..))))))..(((((.(((((((((.............))))))))).)))))((((.(((((..(((.((((((.(((.((((.((..(((((((....)))....)))).)).)))))))..((((((....))))))...((........))(((((((...(((.((((((.....(((((.......((((((((.(((..........))).))))))))...((((((((.((.((((((((((.......(((((((((((..((((((....(((....))).....(((...))).....)))))).))))))...)))))..((((.(((.((((...........))))..)))...))))...........((((((((......))))).))).......)))))))))).)).))).)))))))))))))))))))..........)))))))))))))))))))))))))...(((....(.((((((((((((((((..(((((((...)))))))...))).....))))))))))))).)....)))..(((((((.....)))))))))))).)))).)))).))..)))))))))))..)))))))).....)))))).....(((((((((.((((.......((((((((.....(((((((((((....)))))).))))).))))..))))......))))..)))))))))((((((((.(((((......))))).))))))))(((((((...))))))).((((((((((((((((.((((((((.......((.((((......(((((.(((((............((((....))))((...(((.((((.....)))).)))....)).(((((((((.(((.((((((((((((((........(((.((((........)))).)))..)))))).....((((((....((.((((..(((((((...(((((....(((.((((((...)))))))))((.(((((....(.((((((((....((((((..(((((.....))))).....)))))).....)))))))))...))))).))((((....))))(((((((....)))))))(((((((.(...(((.....)))..).))))))).....((((((.....(((......))))))))).....)))))..)))))))..))))))....))))))...((((((.((.......((((......))))........))))))))..))))))))...)))(((((((.(((.(((((((((((...((((.((((......)).)).))))...))))).)))))).))).)))))))......))))))))).(((.((((....)))).)))((((((((....((((((...........((((((((......(((.....)))......)))))))).(((..(((.(((.(.(((..(((((((................((((((.................(((((((.((((((.....(((((((((((.........))))))).))))..((((.(((((((((((..(((((((..(((((..(....)..))))).))))))).(((((.((((.(((......))).(((((..(((((..(((.....)))..)))))...))))).(((((((((((.....)).....(((((((......)).))))).)))))))))....))))...)))))..((((((.(((((((....)).))))))))))).....(((((.....)))))(((..((((((((.((((((.(((.((....)).))).)))...((((((.((...((....))...)).))))))...))).)).....)))))).)))....)))))))))))..))))..(((((..((((((....)))))).............))))).........)))))).)))))))))))))((((.........)))).((((((..(((.............))).))))))...)))))))..))).))))..)))..)))))))))..)))))))).))))))))))......)))).))))))))))))))))).)))..))))))...)))))))......(((((.(((((((((..........))))))))).))))).((((((..(((..(((((...)))))......)))..))))))((((((.......((((...((((((((..(((((((.(.((((.(((....))).)))).)))))......)))..)).))))))....))))..........))))))...(((((((.((((((((((.(((.(((.(((((((.(.((....)).).))))..))).))).))).))))...))))))))))))).........)))))))))).))))))).)))))))))))))).)).))))))....................))))))))))..)))......)).))))))))))))))))).))))))).).)))))(((((..........)))))))))).).))))))))...)))))))))))).(((((((.............).))))))....((((((((((((((..((((((((..(((((((((......)))))))))..)))))))).)))....))))))........))))).)))))..)).(((((.....(((((..((((((((((.(((((((((((((((......)))..(.((((.((((((((((((.((((((((((.(((((.((((.(((.(((......((((......)))).))).))).)......(((.((((((((((........)))))))))).)))......))).))))).))))))))))...)).)))))))))))))).).))))))))..))))((((((((((((((((((....((((((((....((((......(((((.(((.....((((.((((.(((((.(((.............))))))))))))...))))))))))))....))))...))))))))....))))).)))))....)))...)))))....((.((((.....)))).))....(((((...(((...)))....)))))))))))))))....))))).)))))..((((.((((((((((...((....(((((((((((((..(((....((((((.(((((......))))).)).))))...))).......)))))))))))))...)).)))))..))))).))))...........
Thermodynamic Ensemble Prediction
.,,,{((((.((((.((((((((((((((((.,..,(({(({{(((((.(.(((.(((.(,(.(((((({{.(((...(.((.((((.(((((.(.{..((((..((((((((((((((((((((..(((........)))..))))))))).,((.{{(.{(((..,....}})}...}})})},..,)))))))))).))))}}))))).)))))).).....,)))}}..)))))),,,)))}))}})))))|{(,(((((((((((((({(.,.,.................)).))).))))).)))))).))).|,|||},|,{(((((({((((((.((((((((,{,{((((((((((.(((.((.,{....,....,},,}}.))).)))))))))},,{{...,.}}||(((((((((.(((((.(((((((((({{(((((((.........(((((.{((((((((....))))))))}.((((((({((((((((((({{,{.,,......,({{(.,......},},}}.))))).))))))........,..,,,.......|||,.|{,.,,||.}||,.((((((((((.(((.((......)).)))(((((((((((.....)))))))))))......))))))))))..,,|,|,....,}})})),,))))))))........})))){((((....)))))..........{{{,.{{,...,...,}}...(((......)))..........,,,...||.(((((((.((((((((........)))),,.,)),..((.....)}))))))).,,.)))))))))))))))},)){(((((.(((({{.((((,{({.......(((((({{{((.{{{(((...((((((((((((((({{{,,,........||||.((((.((((((.((((((..{{{{{......,.},,,}}....(((((...)))))(((((.,,..(((((.((((((((,,,{{(((,.,|||||{|{{(((((,{((.....((((......))))..,}}|}}}}||{{{{..{((.,..{{.((((((((({{(.,..{{,..,{|{,{{,.(((((((((.{{(.((({..,.......((((((,,,,.{{,...))).....)))))}....,,)))}..}}).....))))))))){(((((....)))))),,.,|{{{.,..,||((,({{.{{|}|||((|..,,,..,.||||..}}}},,.||||||||,,|},,}))}))}.))),)))))))))).)),,.))).}},))}}}.}),,}|||.|((((...)))).}.,)).)))))).))))).},.)))))..))))))....)))))).)))).)))))))))))),...((((((.((((....({.((((((........)))))).))...))))))))))}))))),.})),}},..}))}}))))))..,|,||,{{(..,,))}(((((((((....)))))))))..,,})))))).)))).))))))))))).}.))))))))}}..{(((((((..(((((.......((((((((.(.((((((((..,((((..,,,{{,.{((((({......)),}))))}.,,.....,}))),...,.))||,..,})),...(((((((.....))))))).(((((((((((......((((((((((.{.(((((.((((..(,.........}..))))..))))),,}.)))).....(((({.((((.(((((((((..((({.,,..||,(((((((.(((((.........{((((....,,,.....,,,...)))))))))).))))))).....,},...,},)}..)))}}))).)).)))).})))).......})))))...,,....))))))),),))..})))).))))))))......((((((,(.((((((((((((((.((.......,(((({{((({...}}}}|((((((((((.{,,{{{,,.((((((,,((((((((.(((((((((((..((.((((.((((.{((((,...((((((.(((((...}})))..))))))..(((((.(((((((((..,,....,},..))))))))).))))){(((,{{{((..{((,{{((({,{((,((({.,,..((((({{....}}),,.,)))},}}.}))),)),.{(((((....)))))}.{{{,.......,}{(((((((({.(((.((((((.,,.{(((((.{{{{,.,(((((((.(((((.....))}))).)))))))|,.,,,,,,|{(,{{|(((({(((({.......{,{{({{((((,.((({{{....,((....,,}.,{..(({...}))..,,.}}))}).))))}}|,,}}},,..(({{.{{{.((((...........)))).,))),,,}))),,,,....,{{{,,,||||......||||||.||{{.....)))),))))),,))))).)))))).)),)))))))))..,..,....)))))))))))))))}))))))))}...(((....(.(((((((((((((({{,.,((((((,..}))))),.},},.,...}))))))))))))).)....)))..(((((((.....)))))))))))).)))).)))).))..)))))))))))..)))))))).,,,.)))))).,,,.(((((((((.((((.....,.((((((((.....(((((((((((....)))))).))))}.)))),,))))......))))..)))))))))((((((((.(((((......))))).))))))))(((((({...))))))}.(((((((((((((((,,((((((((........{{({((......(((({,(((((.........,,.((((....))))((.{,(((.((((.....)))).))).}}.)).(((((((((.(((.((((((((((((((........{((.((((,.......)))).))},.))))))..,.....,||..,..,|||||..,,,{{{{,..,,..,,)))||,.{{((((...})))))}},{(.(((((..,,{.(((((((((,..,((((,..(((((.....)))))..},,)))))}...,,}))))))),.,,))))).)){(((....)))}(((((((....))))))),.((((((((((((({,{(..((((((({{(((.{,((.((((((,....{((......)))))))))))},)))))))}}})).,....)))))))))))))))).{((((((.((.{{{...((((......))))....}},.)))))))).}))))))))...)))(((((((.(((.(((((((((((.,.{{{{.,,{{,,...,|}.}..}))).,.))))).)))))).))).)))))))......))))))))).(((.((((....)))).))){(((((((,...(((({{...{{...{{{((((,,,,}}}}}}|,,,,,,,}})},,..,)))))}}|,{((..(((.(((.(.{((..(((((((....,,..........((((({..........,,...,{(((((((.((((((.,,,.(((((((((((.........))))))).))))..|||{.(((((((((((..(((((((..(((((..{....}..}}}}}.}}}))}},(((((,({{{.,{,.{{{{,||},{{{|||.,,{{{,,{|{,,...|||{{|||,,.,.||))),||||{,,,,{(.....)).{{{.(((((((......)).))))).}))})))).....}))}.,,)))))|.((((((.(((((((....)).))))))))))).|...(((((.....))))),{,..(((((({{.,,,{{{.(((,{{....}}.}}}.,}|{{,{{{{||,{{...{{....})...)),)))))),}}),}.},,,.,.)))))).}}}},,.)))))))))))..|||,..(((((.,((((((....))))})},.......,,..))))),,.......)))))).)))))))))))))((({.........}))).((((((.,(((........,},,.}}}.))))))...)))))))..))).))))..)))..))))))))).,}))))))}.))))))))))......}})),)})))))))))))))))},))..))))))..,|||||||,,.{,.(((((.(((((((((..........))))))))).))))),|{{{{{..,,,..,,|||,..,,})},..,,,,}}..,,,}}}((((((.....{,((((...((((((..{{(((((((.(.((((.(((....))).)))).)))))......},}}})..))))))....))))...,....,,)}))))..,((((({({((((((((((.(({.(((.((({(((.(.((....)).).))))..))).))).})).))))...})))))))))))).}...,,,,))))))))))}))))})).)))))))))))))).),.)))))))))))....)))))))),}}},||.,,,||.|{|{....,.})))},)))))))))))))},||||}}},|,||,,.{||||,,},,.....,}}}})))))})}))))))))...)))))))))))).)))).,{{{{{.,....((({.(,(((((((((((((,,((((((((.((((((((.,(((((((((......))))))))),.)))))))).,,...,,|||}}}...{{{((.{{{|{.{((.{{,.,,,,|}.|||,||}}}.}}}},....,,.(((((((((((({((......))}..{.((((.((((((((((((.((((((((((.(((((.((({.(((.(((......((((......)))).))).))).}......(((.((((((((((........)))))))))).)))..,...,)),))))).))))))))))...)).)))))))))))))).),)))))))}.,)))).,|,,((.((((((((((....((((((((....((((......(((((.(((.....((((.((((.(((((,(((.{.,.....,.,.}}})))))))))...))))))))))))....)))),..))))))))....))))).)))))}}},))}},.))))))})))).)))},..|}})),.)})),,},,}})))}||||,{{,,,.,{{{|.......,,......})))}..||,|,,(({{.{{|||||{||...||{...(((((((((((((..(((....((((((.(((((......))))).)).))))...))).......))))))))))))).,,}}.})}},..}}}}}.}))),..........

Transcripts

ID Sequence Length GC content
AGACGGAGCUGGAGCGGCGGGGCGGCGGCGGAGUCCGGCGGCCGGGAGA… 5589 nt 0.4205
Summary

This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]

Forensic Context

A study in mice demonstrated that acute prenatal alcohol exposure down-regulated the PAFAH1B1 gene (Pafah1b1) by -0.22 Log2FC in the rostroventral neural tube two hours post-exposure, an alteration associated with hypoplasia of the brain stem [Boschen et al. DOI:10.1016/J.Alcohol.2022.09.001].