Basic Information

Symbol
PARD3
RNA class
mRNA
Alias
Par-3 Family Cell Polarity Regulator PAR3 ASIP PPP1R118 Bazooka PARD3A Baz Atypical PKC Isotype-Specific Interacting Protein Protein Phosphatase 1, Regulatory Subunit 118 Par-3 Family Cell Polarity Regulator Alpha Partitioning Defective 3 Homolog CTCL Tumor Antigen Se2-5 PAR3-Alpha PARD-3 Par-3 (Partitioning Defective 3, C.Elegans) Homolog Par-3 Partitioning Defective 3 Homolog (C. Elegans) Atypical PKC Isotype-Specific-Interacting Protein Par-3 Partitioning Defective 3 Homolog PAR3alpha SE2-5L16 SE2-5LT1 SE2-5T2 PAR3A PAR-3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001184785.2
Sequence length
5971.0 nt
GC content
0.5009

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2013.60 kcal/mol
Thermodynamic ensemble
Free energy: -2118.30 kcal/mol
Frequency: 0.0000
Diversity: 1345.62
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.........((((..(((((((.(((((((((((.((((((((......((((((.(((((.((((((.(.((((.((((..((...)).(((((.(((.((..((.(((...(((.(((((((.((((((((((.(((.((.(.(((((((...)).))))))))))).)))))).))))...))))))).))))))))..))))).).)))).)))).))))).)))))).)))))))))))))))).).)))))).))))))).)(((((((.((((.(((.(((.((((((((..((......))..)))).)))).))).))).)))).((((((((.((.....)).)))))))).((((....))))))))).)).....))))))..))))..((.(((((((((((((((((((((((......)))))...(.((((((((..(((((((.(((....((.....))....))).)))...))))..)))))))).)(.((.((..((((..((((...((((((.((((.((((((((.(((...((((((((((.(((((....)))))....(((((((((...........((((((.(((((((((((((..((((....((((((((((((((((((.((((..........))))..(((.((((((..((...((...(((((((..............))))))).))))..)))))))))((((..(((((.(((((..(((((((.(((...(..(((((((((.(((((...))))))))))))))..).)))((((........)))).(((((((...(((((....))))))))))))......((((...))))...............((((((..((((((....((.(((.....(((((((..((((.....(((.((......)).)))((((((..((((((((((((......(.((((((((((((.(((..(((((((.((((.((.((.((((.((((((.....((((((((((..((((((((..(.((((((...((((....(((((...........((((((((.((((.(.((.((((((.....((((((..((..(((((((....((((((((..(((.(((((((((.((((.((((((.....((((....))))..............(((((...((((((....((((.((((((((...))))))))..((((((((..((((((((.((((.((((((...((((......))))................((((((....((((((..(((........)))..))))))..))))))((((.(((.((.........)).))).))))...........(((((.........)))))......)))))))))).)))))))).)))).)))).......((.(((((..(((.((.(((.((((...(((((.....))))).....))))...)))))))).((((.(((.((........)).))).))....)).))))).))))))....)))))).....)))))))))))))))..(((..(((((...))))).)))(((((..((((......))))......(((((.....))))).......))))).))))))))).(((.........)))...((((..(((((.(.(((..((((.((((((((((.((((....((((.....))))........((((((((((((((...))))))).........(((.((((((((((.(((.(((..((((.((........(((......(((((.(((..(.((((((........)))))).).....((((((.........))))))((((.((((((..(((...((((((((......((..(((....)))..)).....((((((.(.((((..............(((..(.(((((((...))))))))..))).(((((((((((..(((((((((((..((((...))))))))..)))))).....)..))))))))))).((.(((((((..((((((................)).))))..))))))).))..((((((...))))))))))).)))))).....))))))))))).)))))).)))).((((....))))............))).))))).........)))..)).))))....))))))...)))))..))))).)))...........(.(((..((((.((((((((((((((...........)))...)))))))))))..))))))).)..))))))))))).)))))))))).))))..))).).))))))))).....)))..))..))))))..)))))))..))))))))...)))))).)).))))).)))).))))))))))))))))))))..)))))))).)))))..(((((.....))))).....((.(((((((((((...)))))..(((((((((..(((..((....))..)))...))))).))))((((((..(((.(((((((((((....))).))))))......)).))).)))))).)))))).)).(((((.((((...))))))))))))))))))))..))))..)).)).)))).)))))))((((((((((((...(((((.(((((......)))))........((.....))...((((((((.((((....((((.((((((......)))))).)))).......(((((((.((...((((..(((......)))........(((.((((........)))).)))))))....)).)))))))....)))))))))))))))))...))))))))))))))).))).))))..))))).))))))))..(((.(((.....))).)))(((((((....(((((((.......(((((((..((.((.......)).))....))))).)).....(((....)))....)))))))....))))))).....))))))))))).))))....)))).))).....))))).......))))).)..)))))).......(((((.(((((.(((..((((((((((.....((......))....)).)))))...)))..))).)))))...............)))))................)))))))....)))))..............)))))..))))...)))))))))))...))))))).(((((.(((..(..((((((....(((......)))((....(((((((.......(((((((((.((((((........)))))).((((((.(((.((((..(((((.((((((.(.(((((......((((((......(....)......))))))(((((....)))))((((........))))....((((..((((((((.((.((((.....((((.((((((((((......(((.((((...((((.......)))))))))))..(((((((((((((((((((((.(....).))))))))))........((((((((((..........((((.((((((...((....((((...((...(((.((.(.(((.......((..((((((......))))))...)).......))).).))))).)).))))....))....))))))...)))).....(((((((......)))))))((((.(((((.((((((..((.((((.(.(((((((((((((.(((((....))(((.((((((((.(..(((...((((((((((((((.........)))....((((.((...(((.(((....((((.(...((((((...(((((((.((((((....((.((((...)))).))))))))))))).))...))).))).).)))).))).))).)).))))((((((........))))))......((((......))))))))).))))))...)))..).)))))))))))(((((.(((((((((((((((.((..........)).).))))))))).((((.((.(.......(((((......))..)))).)).))))......((((((....))))))......((((.....))))..((((((.((((((((...(((((((....)).)))).)...)))))))).))))))..))))).)))))((((((...((((((((((((((((((((...........))).(((((....)))))...((((((((((.(((((...)))))))))).))))).))))))))..)))))))))((((....)))).....(((..((.((((((((...((....))......))))))))))..)))((((((((..((((.((.((..((....))..)).)).))))..)))....)))))))))))...)))))))))))..))))).))))).))..))...))))..))).)).))))))))))))))(((((((.(((((.....((((((.((((((.....))).))))))))).)))))...)))))))....)))))...(((((....)))))((((.(((.(((......)))))).)))).......)))))).................)))))))))).)))))))))).))))))))..)))).............(((((((((((((((.((((((((..(((((((.(((((((...(((((........(((((((((.....((((.((((((......))))..)).)))).....)))))))))...((((((((.....((((((.......))))))..(((((...((((........))))....((..((((((((((.(((((.((((((........))))))))))).))))))).))).))((((((...)))))))))))(((.((.(((((.......))))).)).))).)))))))).(((((((((..((((((((...((((((.(.(((........))).).)))))).)))).))))..)))))))))...)))))..))))))).)))))))..)))).)))).))))).)))))..)))))...)))))..).))))))((((((((((.(((((((.(((...(((((.........))))).......)))...)))))))((((..((.((........)).))..))))....................)))))))))).........(((.((((...((((((((.((((((((((.((((((.....)).)))).))))...................)))))).)))))))))))).))))))))...)))).)))..)))))).....)))))))))(((..(((....)))..))).....)))))))...)).)))))).)..))).))))))))).))))))).).))))).))))))..((((((((((((((((.((((((((....)))))))).)))))).....((((((((.........))))))))..))))))))))......((((....))))))))))))).........))))))))))...))))))))))).)))).))).)))..))))))))..)).)).)...((.(((....))).)).)))))).)))...))))...(((((((((((......).))))))))))((((......))))..((((((...............))))))..))))).)).
Thermodynamic Ensemble Prediction
..,,{(,,,{{(({.(((,(((.(((((((((((.(({(((((......((((((.(((((.((((((.(.((((.((((.(,{,.,|,.,(({{.(((.((..((.(((,..(((.(((((((.((((((((((.(((.((.{.(((((((...)).))))))))))).)))))).))))...))))))),)}))))))..))))).}.)}))})))).))))).)))))).)))))))))))))))).}.)))))).))))))).)}.|||||.((((.(((.(((.((({{({{{{((((....))).)))),)))).))).))).)))).((((((((.((.....)).)))))))).((({....))))||||,.{{{.|..|||||,..}))))}.,,||||||},,,,|(((((((((((......))))).,.(,((((((((..(((,,(({,,,{(.((((.........}))).))..}}))))..)))))))}.),.{{.{{..{(((,.{(((.{.((((((.((((.((((((((.(((...((((((((((.(((({....}))))....(((((((((..........,((((((.(((((((((((((..((((.,{.{(((((((((((((((((.{,.{,.........,,,...,((.((((((..{(...((...(((((((..............))))))),}}})..)))))))}|(({{..(({{(((((((..((((((({((,...{..(((((((((.(((((...))))))))))))))..,.},,(((({{{.....,,||{(((((((,..(((((....)))))))))}||,.....((((...))))...............((((((..((((((.,,,{,.(((.....(((((((..({{,....,({(,({.....,)).))}((((((..((((((((((((......(.(((({(((((((.(((..(((((((.((((,((,((.(({(,((((((.....(((((({((({({,{{(({({,,,,{|||,.{{(((({{,,,{(({{{.,{{{...,,{{{{|||,{{||,||,|.||||||,|,,,|(({((||,|..{||{||||.|||{{|{{{{||{,,.(((((((((.((((.((((((.,,,,,,{{,,,.}|||..........,...(((((...((((((....((({.((((((({...})))))))..{{{{((((,.{(((((((.((((.((((((...((((......))))..,{{...........((((((....((((((..(((.{......)))..))))))..))))))((((.(((.((.........)).))).))))...........{{(((.........}}})).,}}..)))))))))).)))))))).}))).}}}}.......((.(((((..(((.((.(((.((((..,(((((.....)))))..}..))))...))})))}|,(,{(,{{{.,|||......}),}}}.}),...},.))))),)}))))....)))))).....))))))))))))))).......,{{,,,{{,}||,{|||,.,,|}}|{||..,,,.,}}.......{((((...,.|||,,....,.,)))),.))))))))),{{.{{,.{{{{{|{{..,{(({..(((((.{.(((..((((.((((((((((.((((....{(((.....))))........((((((((((((((...)))))))..,,,....(((.{(((((((((.(((.(((..((((.,{...,,,.,({{,.....(((((.(((..{.((((((.,....}.)))))),}.....{(((((..,...,..)))))|((((.((((((.,(({...((((((((.,....((..(((....)))..)).....((((((.(.((((..............(((..(.(((((((...))))))))..))).(((((((((((..{(((((({(({..((((...}))),}})..)))))).....}..))))))))))).((.(((((((..((((((................))}}}))..))))))).))..((((((...})))))))))).))))))...,.))))))))))).)))))).)))),((((....))))....,,......))).))))).....,..,),},.}}.))))....))))))...)))))}.})))}.)))..,........(.(((..((((.((((((((((((((...........)))...)))))))))))..))))))).)..))))))))))).)))))))))).))))..))).).)))))}}}}.|,|...,..,....)))))..))})))},.||||||||{{{||||,,.,...,}})}}|||{|,...)))))}))))))),{{{{{.{|(|,.....))},,})))},,,))})},..,,}|}||||{{.,{((.((((((((......))))))))))}{|||||||..|||||{|{||||}|||.||,|||}|}.,||{{{{(((((....)))}))))}|,|{,,,|||}},.))))|},}||||||,,.{((((.{{{|,,.)))))))))}}}}))))}}}..)))),.}).)).)))).)))))))((((((((((((...(((({.(((((......))))).,......((.....))..|{(((((((.((((....{(((.((((((......)))))).)))}.......(((((((.((...((((..(((......)))........(((.((((........)))).)))))))....)).)))))))....)))))))))))})))))...))))))))))))))).))).))))..))))).})))))))..(({.((({....)))}}}}(((((((..,.(((((((...,{{,(((((((..((.((.......)).))....))))).)),....,{{...,)))....))))))).,..))))))).....))))))))))).})))....)))).))).....}))))..,..,.))))).)..)))))).....,}}||)))|||||}(((,,(,,(((((((.....((......))....)),}))))..))}),.}}),)))))}},,....,.......||,.................,,}},,,....))))},)}...........})}}}..}))}.,.)))))))))))...)))))))}|{(((.(((..(..((((((....|||......|||{.,,..(((((((.......(((((((((,((((((.{.,{...,)))})}|||||,.(((.((((..(((((.((((((.{.(((({......((((((......(....)......)))))){((((....))))}((((........))))....((((..((((((((.((.((((.....((((.((((((({,({{{...,|}||{{(,..{(((,,,....}}}}}}}}},}}}|||{{{{{,..((((((((((.{....}.))))))))))...,,...((((((((((..........((({,((((((,{.((,.,.((((,..,.....,..,,.|}|||...}}}.{{}}||||||...,..,}|||},..||...||..|}}|}.||||}.,..}}})|||.}}.,.,)}}}}),,,)),),....(((((((......)))))))((((.(((((.((((((..((.((((.(.(((((((((((((.(((((....))(((.((((((((.(..(((.,.(((((((((((,({,,.......|}|...{((,,.{|},.{((.((.....,,}|.}}}.{{((((,,,(((((({,((((((....{{.{((({..}))),}}))))))))))),||...}}},.}|,{,||||||||{(({.....)))},,.}},..,}.},))))))}},.,.((((......))))))))).))))))...)))..).)))))))))))(((((.(((((((((((((((.((..........)).)}})))))))).((((,({.,....,..(((({......},.})))..)).))))......((((((....))))))......((((.....))))..((((((.((((((((...,((((((,,..,}.}))),).,,)))))))).))))))..))))).)))))((((((,{.{(((((((((((((((((((...........}}},{{{{{....|||||,,,{(({,{{|{|,|||||...}}}}}|}}}}.)))}}.})))))))..))))))))){||,.,,.|||}.....|||.}|{.((((((((...((....))......)))))))),,..,,,((((((((..((((.((.((..((....}),.}),)).))))..)))...,)))))))))))...))))))))))),,})))).))))),)}....}},})))..))).)).))))))))))))))(((((((.(((((.,...((((((.((((((.....)))},)))))))),)))))...)))))))..,{{{{{(({.(((((.,,,||}}}{{{{|(((.{{{......)))))),)))))))),..)})))),,......(({,...,))))))))))).)))))))))).))))))))..)))).......,,,...(((((((((((((((.((({((((..(((((((.(((((((...(((((.....,..(((((((((.....((((.(,((((......)))).,,}.)))).....)))))))))...((((((({.,,..((((((.......))))))..(((((...((((........))))....,,..((((((((((.(((((.((((((........))))))))))).))))))).))),}}{(((((...)))))))))))(((.((.(((((.......))))).)).))).}))))))).{((((((((..{(({((({...((((((.{.(((........))).}.)))))).}}}}.))))..))))))))),..)))))..))))))).)))))))..)))).)))).))))).))))),.}))))...}))))..}.))))))((((((((((.(((((((.(((...(((((.,.......))))).......)))...)))))))((((..((.((........)).)),,,)))..,.................)))))))))).........(((.((((...((((((((.((((((((((.((((((.....)).)))).})))..,..|....,,.,}.,,.)))))).)))))))))))).))))))))...)))).)))..||||,,..,,.)))))))))(((..(({....)))..))).....)))))))...)).)))))).)..))).)))},)))).))))))).).))))).))))))..(((((((((((((((({((((((((....)))))))).))))))}....{(((((((.........)))))))}..}))))))))).....,(((,...,)))}))))))))).........))))))))))...))))))))))).)))).))).))),.)))))))).,)),))|},|||{,{({....})},)).)))))),)){(((.((((.(((((((((((({{....)}))))))))))).)))}....))))..((((((...............))))))..,,,})})).

Transcripts

ID Sequence Length GC content
ACACAGCCCCGGGCAGCCGCCGGCGAGCGCGCCGCGACGCCGAACAGGU… 5980 nt 0.5010
Showing 11 to 11 of 11 entries
Summary

This gene encodes a member of the PARD protein family. PARD family members interact with other PARD family members and other proteins; they affect asymmetrical cell division and direct polarized cell growth. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]

Forensic Context

A study in human trauma patients demonstrated that the PARD3 mRNA was significantly downregulated in circulating T cells during the injury stage compared to the recovery stage and was involved in the chemokine signaling pathway [Rau et al. DOI:10.2147/JIR.S375881].