Basic Information

Symbol
PARP1
RNA class
mRNA
Alias
Poly(ADP-Ribose) Polymerase 1 ARTD1 Poly-PARP ADPRT PARP PARS PPOL ADP-Ribosyltransferase (NAD+; Poly (ADP-Ribose) Polymerase) ADP-Ribosyltransferase Diphtheria Toxin-Like 1 Poly (ADP-Ribose) Polymerase Family, Member 1 Protein Poly-ADP-Ribosyltransferase PARP1 DNA ADP-Ribosyltransferase PARP1 NAD(+) ADP-Ribosyltransferase 1 Poly [ADP-Ribose] Polymerase 1 Poly[ADP-Ribose] Synthase 1 EC 2.4.2.30 ADPRT 1 PARP-1 ADP-Ribosyltransferase NAD(+) Poly(ADP-Ribosyl)Transferase Poly(ADP-Ribose) Synthetase EC 2.4.2.- PADPRT-1 EC 2.4.2 ADPRT1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001618.4
Sequence length
3978.0 nt
GC content
0.4960

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1342.60 kcal/mol
Thermodynamic ensemble
Free energy: -1415.27 kcal/mol
Frequency: 0.0000
Diversity: 1096.93
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...........((((((.((((...((.((((((.(.(((((..((((((((((((..((((.((((((.((((((....(((.((((((...((.((...)).)).)))))))))..))))))))))))))))..)))))))((((((....)))))).((((((......))))))......((((....))))......))))).))))).))))))).((.((((((((...((((((((((.((((((((((((.((((......(((((((((.((....)))))....))))))....(((((((..((((.((((((.(((.......))))))))))))).((((((((((........)))).)))))).((((((...))))))..)))))))((((((((.((((.((((..(((...(((((.(((((.((((((.(((...(((((((.(((..(((((.(((((((...((((((((((((.....((.((((((((((((((..((((..((((((.((((((..(((((((....((....(((((..(((((.(((.((((.(((......))))))).))).)).....((((((((((((((((..((((((((..(((.((..(((......)))..)).((((((((((..((....))(((((((((((.((((..((((((((.((((((((....(((((......)))))....)))))))).((((.((.((((((.(((.(((....)))............((((.((..(.((..((..(.((((((.(((((..(((.....)))..........................((((....))))(((..(((.(((((((.((((..(((......((......)).....))).)).))))))......))))))..))).))))))))))).)..))..)).)..))))))))).))))))..))..)))).......).))))))).)))).)))))))).))))))).))))))((((.....))))))))))).)))).))).......))))).........((((((..(((..((.((.(((((......))))).)).))..)))(((((.((....))..))))).........((....))(((....)))..(((((((....))).)))).........(((........)))))))))......((.(((((((((.(((...))).))))(((((...((((.(((((.((((((((.((((..((((.(((((...(((((....))))).....)))))(((((...((.(((((.....)))))))...)))))....((((((((.((.(((((...)))))(((((((((....((.....)).....)))))))))((((....))))......(((((((((...((((..........((((((((((...(((.((.(((......))))).)))....))))))))))...)))))))))))))..)).).)))))))))))..)))).))))...((((((((((((...))))))).)))))..((.(((((...........((((((((..((......)).)))))))))))))))......)))).)))))))))...))))).((((........))))...(((((...........)))))...))))).))))))))))..)))..)))))..))...)))))))..)))))).(((.((...(((((((.(((((((.((((((((........))))).))).)....))).)))...))))))).....)).)))))))))..)))).............)))))..........(((((((((.((((((.((.(((((.(((.((..((......))..)).))))))))))........(((......)))(((((((......)))))))........(((((((((.((((.((......(((((((...((((..............((((((......((((..(((((((((.......((((......)))).......)))))))).)..))))..(((((((((((.((.(((.(((((.(((((((......))))))).)).....(((........)))(((.((........)).)))))).)))..))..))))))).))))........(((((((..((((((..........((((...((.((((((((((...((((((((((.((.(((((.....(((((...)))))......))))).))...))))))...((((......))))......((((.((((((((((.(((.((....)).))).))))....))))))...)))))))).)))))))))).))))))))))))...))))))))))))).((((((..((....))....))))))....(((((((....((((...))))....)))))))...(((((((.(((((.((((((.((........)).))))))....((((...))))))).)))))))))........((.((((((....))))))))..........))))...)))))))..)).)))))))))).....)))....(((((((((......)))).)))))...)))))).)))))))))....))))))))).))......))))))))))))((......))))))(((((((((((..(((((((.(((((.(((..(((((((..((((.((((.(((.....((..(((....)))..)).....))).)))).))))(((((((((......))))))))).....((((((((((.(((.(((.(((..(((((....)))))....)))))).)))..))))))))))............(((..(((......)))..))))))))))..))))))))))))))).)))).......(((((....)))))((((..(((((..(((((.....)))))....((((........))))..........((((((..((((......))))))))))...(((((.(((...))).)))))..(((((((((.......)))).))))).((((((((((.....))))))).))))))))....))))..))))))))))))))).)))))))))))))..))))))..(((.(((((....)))))..)))(((.....)))........(((((.(.....).)))))))))).)))))...))).)))))))).))))).))).....)))))))))..))))))).)))))))))).)))))))).))((((((((((..((..(((((((((((.((((((((.((((((((.(((((.......))))).))...............)))))).))).((((.((((.....))))..))))..........))))).)))))))))))(((((......((((((((.(((((..(((((((.........))))))).....))))).))))))))....)))))..........))..))))))).))).............(((((((((....(((((.(((.((((.((((((...(((((((((((.(((((((((((.(((.....(((((.......))))).......))).)))))))..(((.....)))..((((((((.((..(((..((((((.........))))))......)))..))..))))))))....)))).))))))...............)))))......))))))))))))).)))))........))))))))).))...)))))))))).
Thermodynamic Ensemble Prediction
...........((((((.(((({{{(({(({(({((,{{{{{,.{{||({({{{{|,,||{{.((((((.((((((....(({.((((((..,{(,,,...}),,).)))))))))..))))))))))))||||,,|||||||(((({(....}||}},,{{{{{{,.,,,,)})))),,,..,||||....,|||,||||,))))|.|||}|}})}))))||{.((((((((...((((((((((.(((((({(((((.((((((((..(((((((((.((....))))),...}}))))....}}}|{{,.,{{{{..(((((((((.(((((((,,|{||{((((..((((((((((........)))).)))))).,))}}},|{,|.}|||(.(((.....))).).,}}.{||,,|..}}}..))))))).))))))))){{,(((...{|||{{{.||{,.(((((.(({{(((,,,({{{{|||||{{,,,,.{{,|{{{{{{{{.{|||,.{{((..(((((({((({((,,((((({{...,((,,,.(((({.,(((((,(((,((((.(((......))})))).))}.|}.,.,,(({(((({,((((,...}|,||||{|{,,{{..|,.((({,{{{{,||,,..,((((((((,({{((,,..}}|||{{{(((((.((((.,({((((({.((((((((....(((((......)))))....)))))))),{{({.((,((((({{(({,({,..,,||,,,,.........{((({{,..{,((,.{(,.(,((({(.,(((((..,,,.....{|{.....,,,......{,{{........,|||}...,|||({{..{((,{((({.,...|}}.}}}}|....,,..(((({.(((......))).)))))......,}.)))..})).)))})))}))),)..}}.,||.}..,)))}}|||||||}||,{||..}|||,...,}}}.})))))),||||.|}},})}),)))||||||||}}}((((.....))))|||}}}}|||||,|},.}},,,}|||}}......,..{(((({..(((..((.({.(((((......))))).)).))..))){|||{.,{}},,)),,||||,...}}}}..{{....}}(((....))),,(((((((....)))},))).........(((........)))))))))},....{(,(({{{{{||,|||,,,})),))))|||||,,.{{{|.(({||,{{{{|||{,{{{|,,|{{{.(((((...(((((....))))).....)))))(((((...((.(((((.....)))))))...)))))....((((((((.{{.,((((...))))|{({{,,({({{{(((({.{{||.....)))))))))||{|..,.}),)}.....(((((((({..,((((..........((((((((((...(({.{{((((......)))),.)))....))))))))))...)))))))))))))..}}.).))))))))))),,)))).)})).|,({((((((((((...)))))))})}))).{(((...)))}..{(,((,{{((({(((,,((,,,..,||.|||||||}}}}}|||......}}}},))))}}}}}...}}}}}.,{{{.,,.....,|||...,{{|{...........})))}...})))}.|||}}}}}}}.|})}..})))}..}}.,.})))})),.})}))),|{{.|{...{((((((.,(((({{,(|((({{|..}}}}}}))})),),},,....||||.}}...))))})),...,)).)})))))))..)))}.....,.....,.|}},,|{{....,}.(((((((((.(((((({(({,((((.,((,((..{,....,,))..,}.||||}|||||.....}}}||{},,,..,}.(((((((......))))))).....,,,|(,((((({{((((.((,.....(((((((...((((....,..,......((((((......((((..{((((((((.......((((......)))).,.....)))))))).,..)))),.(((((((((((,{,.{((.|{,((.(((((((.....,))))))).)).....,{{........}}}(((.((........)).))),}}.}}}..,}..))))))),,)))........(((((((..(((((((...,,,....{{{...||,((((((((((...((((((((((.{{.(((((.....(((((...)))))......))))).}}...))))))...((((......))))......((((.((((((((((.(((.((....)).))).))))....))))))...)))))))).)))))))))).}}))))))))))...))))))))))))).{(((((,,((,,..|,,|..}}}}}}.,,,{{(((((,,,,({{{...}||}....))))}))...|||||||,||{{|,|{{{{{.{{.,}.,..,)),))))),.,,.{({,...,},.}}),)))}}}}}}......,,((.((((((....)))))))).,,,,}},..))))...))))))),.)).)))))))))).,..})))....(((((((((......)))).)))))...)))))).)))))))))....})))))))},||,..,,.))))))))))))||..,,}})}}})}{{{((((((((..(((((((.(((({{(((..(((((((....,,.,((({(({{(({((..((({{....,,..,,.....,},})),,}))))(((((((((......)))))))))....,((((((((((.(((.(((.(((..(((((....)))))....)))))).)))..)))))))))),}.,.,)))}}.(((..(((......)))..))))))))))..))))))))))))))).)))),},.,,,{||||,,,,)))})||{||,||||,..(((((.....)))))....,{{{.......,|}},..,}}|,...{{{{{{,.((((,....,))))})))}}...{{({{.(({...})).))))}.,{|||||||||.....,}))),))))),|||(((((((.....))))))).)))})}},.,,.}}})..))))))))))}))}}.})))))))))||,.....}|{{{{((.(((((....)))))..))},.}}}|,,|{{,{{{.,,({{{,,.|||.,,},}}}})))})),)))))},,}))}))))},,}}}),,,,}))))),.)))))))))..})))))).)))))))))).)))))))).}||{((((((((,.((({(((((((((((.((((((((.((((((,{,({{((.......}}}}),),........,,...,.)))))).))).((((.((((.....))))..))))..........))))).))))))))))}.|}||}.||.{{(({(((({({{{{(({,((((((...})))}},||||||,,,}))}})}}}}}}|||....,.,,,..,,||.,..,,..}})))})}.}}||.....,}|||,{{{{{{(({..,.{((({.(((.((((.((((((...(((((((((({.{{{(({(({{{.{{{.....((({{.,,,,,.}}}},....,{{|||,||||}},..(((.....)))..,,,|||||}||}},,,..,|||}}}}}.,,|||||}|{{..{{{{,,,..,,.})))..))).}.}))))}))))))).........,,,,,)))))......))))))))))))).})))).},.,,,.))))}}}},.,....,))))))))).

Transcripts

ID Sequence Length GC content
AGCAAUCUAUCAGGGAACGGCGGUGGCCGGUGCGGCGUGUUCGGUGGCG… 3978 nt 0.4960
Summary

This gene encodes a chromatin-associated enzyme, poly(ADP-ribosyl)transferase, which modifies various nuclear proteins by poly(ADP-ribosyl)ation. The modification is dependent on DNA and is involved in the regulation of various important cellular processes such as differentiation, proliferation, and tumor transformation and also in the regulation of the molecular events involved in the recovery of cell from DNA damage. In addition, this enzyme may be the site of mutation in Fanconi anemia, and may participate in the pathophysiology of type I diabetes. [provided by RefSeq, Jul 2008] CIViC Summary for PARP1 Gene

Forensic Context

A study in humans demonstrated that total poly-ADP ribose polymerase (PARP) activity trended to be higher in the subcutaneous adipose tissue of heavier co-twins within body mass index-discordant monozygotic twin pairs [Jukarainen et al. DOI:10.1210/jc.2015-3095].