Basic Information

Symbol
PCDHB13
RNA class
mRNA
Alias
Protocadherin Beta 13 PCDH-BETA13 Protocadherin Beta-13 PCDH-Beta-13
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_018933.4
Sequence length
5061.0 nt
GC content
0.4707

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1615.60 kcal/mol
Thermodynamic ensemble
Free energy: -1709.30 kcal/mol
Frequency: 0.0000
Diversity: 1315.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((((..((((((....(((((.((.(((.(((((.....(((((((..(((((((...((((((((((...(((((((....)))))))...............(((((((...((((.(......))))))))))))..(((((((((....)))))).)))..)))))))))).....((((....))))..........((((((((((....((......)).((((((((...((((((.((((((((.(((....)))......((((.((....)).))))((((((((....))))).)))))))))))..))))))....))))))))........(((((.((.(((((((((((.(..(.(((...(((((.((.(((((((((((((((....((((((((((...(((.((((((((((((...(((((((((.((((((...((...((..(((((..(((((((........)))))))((((((....)))))).....)))))...))...))....))))))...)).))))))).....))))))))))))..))).............(((((..((((((((.((((......)))).).).))))))..))))).((((((...))))))..)))))))))).((((.((((...((......)).((((......((((((((.........((((((................(((((((((....((...((((((((((..((......)).(..((((((((......))))))))..)..(((....((.(((....))).))....)))......(((..(((((((((((((...(((((((((...)).))))))).....(((((((((((((((..(((...((((.(((.....(((....)))....))).).)))....)).)..)))).)))))..))))))..((.(((((((((.....((.(((((.........((((.((((.......(((((((((...((((((..((((((..((.((((((.....((((((((........))))).))).((((((((..............))))))))........)))))))).))))))...(((((.(((..(((((((((((((...((((((...(((...(((((....((........))...)))))..)))...))))))))).))).....)))))).)..)))))))).(((((...((((.(((((..(((....))).))))))))))))))...........)))))))))))))))....)))))))).((((((((((........))))))))))))))).))...))))))))).))......))))))).))))))..))).....((...))..............))))))))))...))...)))))))))....)))))).......))))))))((.((((..(.((((((.((((..((((...((.((((((...........(.((((((((((((((........)))))..((((..((.((((......)))).))..).)))((((((.(((.(((.(((......)))..(((((((..(((((((((..((((...(((.(((...................((((((.(.((.((((((((...((((.(((((....((((.((((....))))..))))....)))))))))...).))))))).)).)....))))))))).)))..))))...)))))))))((((....))))((((((((((.(.(((....(((....))).....))).).))).)))))))((..((((((.((((((.(((((.....)))))...)))).)).))))))..))....)))))))...(((((((((((((((((((.(.(((((......)))))).)))))).))).)))))....))))).)))))).))))))..)).))))))).)......)))).)).))((((((((((.(((((..((..(((...))).))..)))..)).))))))))))..))))..)))).))))))..)..)))).)))))).((((((.(..((....))..))))))).))))))))..))))))))...))))))))))))))...))))..))))))))))))))...)))))(((((((.....))))))).)))))))))))))))))..)))))))..))))).))).)).))))).((((((((((.((((((((((((((((((((.(((...(((((((((((((..((((((((((((...)))))..)))))))..)).....((((((((((..(((.(((...(((((..((((.......))))..))))).))).(((((((((((...((....)).))))))).))))..(((((((((.....(((((((((....)))))..........((((........)))).(((((.....))))).(((((..............)))))..........(((((((........)))))))..(((((((((......................((.((((((......)))))).))....((((..(((((((((((........((.((((..((((((((((...((((((((..............))))))))...))))..))))))..)))).))..((((((...)))))).((((((......)).))))........(((((.(((....((((.((((((((.(((.(......(((.((((.((((((.(((...((((((((.(((.((((((((((..........))))))).))).))).))))))))..............(((((((...(((.((((....(((.((((..((((((((((((..........((((.(((((.......))))).))))..........))))))......))))))..(((((((((.(((.......((((((....))))))....(((..((((....))))..)))......(((((((((...........)))))))))((((..((((((.......)))).))...))))..))))))).)))))..((...(((((((..(((((((.((((..((((((((.....(((..(((((((((....))))............)))))..))).....)))))))))))))))))))....)))))))...))..(((((((((............(((((.....(((((....((((((((((((..(((((((..(((.((((................(((((.(((((..(((((((...............)))))))........(((((....(((((((...((((((((...........................))))))))...)))))))...))))).....))))).))))))))).))))))))))...)))))))))))).....))))).....)))))..(((((.....)))))......))))))))).....)))))))...)))))))...)))))))........))))))))).))))))).(((((((((..(((((..(((((.((((((((((.(((..(((.(((.....))).)))......))).)))))...)))))..)))))..))))).......))))).))))..((((((((..........)))))))).........).))).)))).)))).))))....))).))))))))))))))))..))))..))))))))).)))).......)))))))))..............))).)))))...(((.(((..(((...(((.(((((..........))))).)))...))).))))))..(((((.(((((((((((((((.((((............))))..))).)))))))..)))))...)))))))))))))))....))))))...))).)))).(..(((((((.....(((....)))..............(((((((.......)))))))((((((((((.......((.(((((((.(((((......))))....).)))))))...))..............(.(((((((((.((..(((..(((((((((((...((((......((((((...........))))))......))))((((((((((.((((.(((((((((((.(((((.(((((.(((((...(((..((.(((.....((((......))))))).))..)))...))))).))))........).))).)).))))))))))).))))..............((((.((((((.........)))))).)))).))))))).)))))))))).)))).))).)).))))))))).)..))))))))))...)))))))..)..))..))))))).))))))).((((........))))......)))).))))))............((((((((((.(((((((.......((((.............((((((((...))))))))(((((((.((((((((((((((.((....)))).))))))..))))))...)))))))((((((.....(((.(((..........(((((((.......)))))))..............(((((.(((((..........(((((..(((((((((((.((((.((((....)))).))))...))).))))))))....)))))...))))).))))).))))))))))))))))......)))))))..)))))))))).....))))))......))))))...(((((.........)))))......
Thermodynamic Ensemble Prediction
....((((((,.{{{{((......{{(.(({...,(((((..((((((((((((((...}}}..((((((((((.,.(((((((....)))))))...............(((((((,..{(((.(.....,,)))))))))))..(((((((((....)))))).)))..)))))))))).....((((....))))........{(((((((((,(({,,(((,{.{{(..(({(((((.,,({{{{{.||{|||||,|{{...,))},,,...{(((,((,..,}}.}|}}((((((((....))))).)))}|}|}}}},,|||}}|,,.,|||||||}..}},...})),,||||{|||,((((((((.{,......},)))))))).(((((((.((((((,{{.((((((((((...{{{.((((((((((((...,((((((((,((((((.,,((...,{,.{{{{||{{{{{{{{,|,.,}},})}}}}|((((((....))))))}},..)))))}..,,...}}.,,,||}}}}...}).))))))}..,,,))))))))))))..}}}.............(((((..((((((((.((((......)))).).)}))))))..))))).((((((...))))))..)))))))))).,}...,,,..........,{{{{|,}{,,.......|,,.,..}})))}...)))))).)))))))...,}|||||}}}.,))))}....((((.((((((.(((...{(((((,{({{{{|||,,,,,,|||||||}..{{.(((((....((((((((((((,,,.(((((.((((.((((.(((((((((((((...(((((((((.,,||,|||||}}.,,,,{({{{{{{{||||{{..,{,...{{{..,{{...,,|||},..||,....,}},),))),}}}),.},{||}||}|}}}..)))))),,((.(((((((((.,,,,({.(((((,,.......((((.((((..,,...(((((((((...(((((({,.{(({....}}}.|})).,,,.((((((((........)))}}.))).((((((((..............)))))))).....((((((......))))))...(((((.(((..{((((((((((({...((((((...(((...(((((....((........))...)))))..)))...))))))))).))).....)))))).}..)))))))).(((((,,,(({,,(((((..(((....))).)))))))))))))).|||||...}}))))},))))))))).},.)))))))).((((((((((........))))))))))))))),)),..))))))))),)}......))))))).))))||(((((((((((.((((.(((((,.....{((((({....((((((((.(((((((.......((((......)))){{{...{{{,{{.{{.,...})}|.,|||,.,))}}..|,{((.(((..{{{....{((((.(((...,(((((.,,.....}}}}}..,{,.{((((((((.{.{(((((((,.((,(((({{,(({((,({{,.,((({{{...|||..||||.......,((((,.((((((((((((...(({{.(((......{,.{{.(((((.(({...,{((((((,..(({{.|{|||,,|}{{{{.((((,,..}}}}..))))}},,||||||||,.,,||,}}|||}|((((.({(((((({(,((.{{((((((((..|..,}..)))))))).),),}).)}|||,}}}}}|}}}..,{,....,}||||..,||||||{|}}|,}}))}}..{(((((.((((((.(((((,...,)))))...)))),}).)))))),||,.|||)).))))).)))){(((((((({.{{((({{.,|((((((.....)))))}}}})){(((((((((...((((.((..(((((.((.|..{(((.(((((((((((.........)))))).)))}}).))))}.)).)))))....)).)))).))),..})))))){(.(((.((({.......)))).)))..}},})},)).))))))))))}..))).))))})))}},)).}|||,.....}))),.,,,|{((((((...))))))||,...||},..)))|,((((((((..((.((((({(.....))))))))))))))))).))})))}..}}},,..........))}))},))))}.)))))).)),,)))))},,))),}.))))))}||{{{.(({((((((((((({,(({(((((((((((.......)))).))))).)),),})))))))....{||,||...}|,|||,}||||.))}.))))))}),..))).))}(((((((((((...((....)).)))))))},))).....))))))}.,{{..,.(((((....))))),..}},....((((........)))).(((((.....)))))........)))))))).})))}})}.......,,,,,..,{{{,...,,.,,{(((((((,...,}|,||.((((((,.,,((({{........(((({......}))))(((((..((((,....{(((.(((((((((((((.((((,,,{{{{((((({...{{{{{{{{....,,,,....,,||}|||||...}))))},))))).||}},,||,.,{{{{|.,.,},,,,.{(({{({.....,)})))}...,,.,.(((((.{{{....((((.((((((((.(((.{......(((.((((.((((((.{({...((((((((.(((.((((((((((,,....,,..))))))).))).))).))))))))..........,,,,{{{{{{{...{{|,((((....(((.((((..{(((((((((((.,,,...,,.((((.(((((.......))))).))))...,,}.,,,))))))......))))}}..,,{{({,{{.{({,,...,,{(((((....))))))|...{{{,.((((....))))..})),.....(((((((((...........))))))))){(((..((((((.......)))).))...)))),.}}}}}}},,}}}}..((...(((((((..((((({{.((((.,((((((((.....(((..(((((((({....})}),...........)))))..))).....)))))))))})))))))))....)))))))...)).|((({(((((,,.......,|||||||.....{((({....((((((((((((..(((((((..{{{.{{{{{{((({...,,}}},.{{||,.||{,,..(((((((...............)))))))........,{{||....(((((((...((((((((........,..........,,,.....))))))))...))))))).,,||||,...{,||,,,.)))),,})),))))))))))...)))))))))))).....})))).....,},,,..{{{{{.....))))}.....,})))}))))}},..)))))))...)))))}),,.}}}))}}.,,,..,.,}})))))).))))))).(((((((((..(((((..(((((.((((((((((.(((..(((.{((.....))).))}......))).)))))...)))))..)))))..))))).......))))).))))..((((((((.,........)))))))).........}.))).)))).)))).))))....})}.)))))..}})))).))))))))..)))))))))))))..))))).})))))))))))...}}.........})))))}}}(((.(((..(((..,(((,(({{(..........})))).))),,.))).)))))).{(((((.(((((((((((((((.((((..,{,.....),))))..))).)))))))..)))))...)))))|{{...{{(.......)))...})}}...(((((((((((..((..(((({{(((....((.(((...(((((...((((.{{{.{.,({(.{(((((...........,..(((((((.{((({......})))....}.)))))))...))))).},))}..}},))))...)))))..))).)).,..))))))))...((((......((((((...........))))))......)))).))..)))))))))))(((((((((((.((({(((.((((.{{........,,.)))).}}}.{((((......)))))......,,{,..||||...,,,..,,}},}},,.}).)).))))))))))).,...,}}}}}.,,)},,...)))))))))))},.......(((((...)))))...},.)))))))))))))((((((.((.......)))))))).....,}},,..})))))))),,))..))))),}|,{{||||{..,.(((((((.(((......(((....)))....)))...))))))}..}..})}}}}}..,,.....,,,,,}},},,,......((((((((...)))))))).,..((((.(((((((((((((.((....)))).))))))..})))))))}.))))))))).)))))),..))))|}|}}||||,.(((((((.......))))))}.,{{{,....}}}}}..||||||||,,,||,.|,.|||}},,,|||||,|||{,|,||}||||}}}..|,|{|||,...))))),)))))))))))))..))))},...}||,|}},},})))}},...((((.({....)).)))).,,,,,....|||{||||}}....,))))))),..(((({.{,....}}))))).,,...

Transcripts

ID Sequence Length GC content
GCAGCUCCAUUAACCGGCAAAAAGCAGCAGAACCUGGAAGUCCACGGGG… 5061 nt 0.4707
Summary

This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the mRNA of the PCDHB13 was up-regulated 2.81-fold in bone marrow cells 6 hours after a whole-body dose of 6.5 Gy ionizing radiation, identifying it as one of many differentially expressed genes involved in the response to radiation injury [Dai et al. DOI:10.1080/09553000600857389].