Basic Information

Symbol
PCDHB5
RNA class
mRNA
Alias
Protocadherin Beta 5 PCDH-BETA5 Protocadherin Beta-5 DKFZp586B0217 PCDH-Beta-5
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_015669.5
Sequence length
3410.0 nt
GC content
0.4968

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1136.60 kcal/mol
Thermodynamic ensemble
Free energy: -1194.95 kcal/mol
Frequency: 0.0000
Diversity: 687.82
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((.((..((((((((((.((((((..(((((.(........))))))..))))..((.((((((..........))))))))(((((((((...))))))))).(((((((((........((((((((((((.(((((((((((.(((((((((((((....((((......(((((.(((((((((((.(((...))).))((....))......((((((((.((..(.(((((((((.......(((((((((.((.((.....((((((((.((......(((((((....((((.....)))))))))))...(((((...))))))))))))))).....)).)).)))))))))....))))).((((.(((((((....((.((((....((((..(((((((((((......))...............(((((((.((((.((((......))).)..)))).....(((.....)))..........((((((((((((((((((........))))))))))))).))))))))))))(((.((...)).))).((((((....))))))(((((.......)))))............))))).))))..)))).........(((((((.........)).))))))))).))(((((.......)))))........))))))).)))).......)))))..)).))))))))..))))))))).)))))................)))).....)))))))))))((((((((((((((.((((((((((.((((((...((((((((((((((.(((((....(((((...)))))...((((((((....).)))))))))))).))).)))))))..((((((((((((((.(((((((..(.....)..))))))).))....)))))..........((((((.((.(((((.(((((..(((..((((((.(((((....)))))(((((((((..((((........)).)).((((((((.((........))))))))))......))))))))).........(((((((((...................(((((((((((.....))))...)))))))..(((.(((((((........)))))....)).))))))))))))))))))..))).)).....)))))))).)))))))))))))))........((((..................))))..)))).))))))))................((((((...(((((....((((((..(((((((...((((..(((((((.(((.(((.(((((........))))).((((((((.....((((....))))....................(((.(((.(((.((((.((.(((((((.(((((((((...((((((..(((..(((((((((.(((((..(((.((((((...(((((......((((............)))))))))))))))..)))..)))))..((((.((((......................(((.((((((.......((((((((.((.(((......(((..((.((((......(((((....((((((......((((.(((((((...((((((((((((((((((.(((..(((.((((((.((((((.(((.((..(.((.(((((((...(((.(.(((((....((((.((((....))))..))))....))))).).)))...)))))))(((((((.(.....).))))))).)).)..)).))).))))))..)))))).)))..))).)))).(((((..((....))((((...((.(((((.....))))).))((((((((((((.(((((.....)))))...)))).))))))))))))....))))).....))))))))))))))..))))))).))))......)))))))))))......))))..))..))).))).))..)))))))).......)))))).)))..)))).)).))((((((((((.(((((..((..(((...))).))..)))..)).)))))))))).(((...(((((.(((((((((((((.((.((((..((((((.(..((....))..)))))))..((((......))))......))))..))))))))(((((..(((....)))..))))).))))).)).)))))))))))))))))..)))..))))))......)))))..)))).))))))).))))))))))))..))).((((...((((((((((..(.(((((((((((((((((((((((((.(((.(((((((.......)))).))).).)))).))))))))...((((.....)))).((((((((.......)))).))))))))...))))..))))))).)..))))...)))))).))))))))))))...)))..))))))).)))..))))...)))))))..)))))).))))).))))))...))))))))................((((....)))).))))))))))))))..............)).))))).(((.((((.(((((((((((..............(((((((((............(((((((((((((..((.((........)).)).)))))....))))))))))))))))).......(((((.........))))).........)))))).))))).))))..)))..((((......))))))))))))))).......(((......)))...((((((((.........)))))))))))))))......))))))))).................(((((((......)))))))....((((((((......((((((....(((.(((((((((.(((((.............................))))).))))))))))))..))))))(((((.((((......)))).)))))...))))))))))...))).))))))).)).))))))......((((((((((...(((((((((((((((((...............))))))))........(((((.(((((....((((........)))).........(((((((((((.((((.....(((((((...)))))))................................((((.(((((....)))))))))...........)))).)))))..))))))))))).))))).....)))))))))))).)))))))..
Thermodynamic Ensemble Prediction
{(((((,((,,((((((((((.((((((..(((((.(........))))))..))))....,{{,,(({{{{,,.{{{|||||||.(((((((((...))))))))),(((((((((...,....(((((({({(((.(((((((((((,((,((((((((((....((({......(((((.(((((((({((.(((...))).))((....}}...||{((((((((.((..{.,(((....))}.....(((((((((.((.((..,..((((((((,(,......,{{{{,,,{{|(({{,{{{,||,,,})})))},.{{{{|.,,)))}),,))))))))..,..)).)).)))))))))..((((({..((((.(((((({,,,.,,.(((((({,((((..((((((((((,(,....))...............,{(((((.,{{{.{{((...,,.}||,..,|||,..,}}||||,,,,,},.....||,..((((((((((((((((((........))))))))))))).))))),)})))|{{{.{,...,},||},((((({....)))))){{|||.......}}}}}............))))).))))..))))....,,...{(((({{.........}}.))))}|||,.}},|||{......,))))),,.....,))))))).))))..,.))))).,}..)).)))))))).,))))))))).))))).......,......,))))).....))))))))))|((((((((((((((.((((((((((.((((((...((((((((((((((.(((((....(((((...))))}...((((((({....}.)))))))))))).))).)))))))..((((((({((((((.(((((((..(.....)..))))))).))....))))}..........((((((,{(.(((({{(((((..(({..((((((.,{{((....,}}}|{({{(((((,.{{{(,,,,,...)),}}.||||{{{{.((,,......|}}}})))}).,,,,.||||}}}|}.,,,..,..{((((((((.......,.........,.(((((((((((.....))))...)))))))..{{{.{{(((((........)))))....)).}}}})))))))))))))).,))).)).....)))))))).))))))))))))))).,(({...,,{,........,...,}}...,,,,..)))).))))))))................((((((...(((((....((((((..(((((((...((((.,(((((((.(((.(((((((((({{.(({.|||||,((({((.{,,.,,,{|{|{{||,|({(({{..,,{,.....,}},,,,....|||(,((((.((.(((((((.(((((((((...((((((..(((..(((((((((.(((((..(((.((((((...(((((,,,...{{{{............)))})))))))))))..)))..)))))..(({(.((((.............,........((({(,{,,,...}}}}|(((((((.((.(((,.....(((..((.((((......(((((....((((((......((((.(((((((..,,(((((((((((((((((.((,{.((({,((((({((((((.{{({((..{..,.(((((((...(((.{.(((((..,.{{((.((((....))))..)))),,..))))).).))).,,)))))))(((((((.(.....).))))))).)),}..))}},)}))))))}.)))),).)),}})),.,|||.(((((.,({....,}{{{{.,,|{,({(({...,,})))).,|((((((((((((.(((((,...,)))))...))))}}))))))))}})....))))).}},.))))))))))))))..))))))).))))......)))))))))))......))))..))..))).}}}.))..)))))))}..,,.,,))))}).}},..)))).)).))((((((((((.(((((..((..(((...))).))..))),.}).)))))))))).(((...(((((.(((((((((((((.((.((((..((((((.(..((....))..,))))))..((((......))))......))))..))))))))(((((..(((....)))..))))).))))).)).)))))))))))))))))..)))..))))))......)))))..)))).))))))).)))))).,)),)}.))).||||...||||||{{{{..{.(((((((((((((((((((((((((.(((.(((((((.......)))).))),).)})).))))))))...((((.....)))).((((((((.......)))).))))))))}..,})}..))))))).),.)}))...)))))).))),)))))})))),}))..))))))).)))..))))...)))))))..)))))).))))).))))))...))))))))................((((....)))).)))))))))))))),.............}}.))))).(((.((((.(((((((((((....,,,,,{{...|||||||{{,{,,,..........,{{((((((...,|,||}||},..,|{{{{{,....}}}}}}))}}}}))))),,,,....,..{{{{{.......,.}))),.,.......)))))).))))).)))).})),..((((......))))))))))}))||.,{{{,,(((......)))...||||||{,.|,,}},,,},,,,,,})))))))......))))))))).......,,.....|{,((((({{......))))))),},,|||{,{{,......{((({{....(((.(((((((((.(((((.........................,,..))))).))))))))))))..|}},,,(((((.((((......)))).)))))..,))))))))}}...}}),)),}))}.},.))))},......(((((((,,{...(((((((((,(((,,,{.....{{{{{{....,,}),)))}}}.....(((((.(((((...,(({{........}},,.........(((((({((((.{(((.....(((((((...)))))))................................{(((.(((((....))))))))}...........)))}.)))))..))))))))))).)))))..,}})))))))))..}.)))))))..

Transcripts

ID Sequence Length GC content
AAGAGUGUGGAUAGUGGGCUCUGCGGAUAACUCAGACGCCAUUAAGCUG… 3410 nt 0.4968
Summary

This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that chronic cocaine exposure and withdrawal induced complex transcriptional changes in the nucleus accumbens, with the PCDHB5 showing a transient increase in expression specifically during cocaine administration [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X]. In rats, network analysis identified the PCDHB5 as a member of a brain co-expression module associated with alcohol consumption, though its expression was not detected in the RNA-Seq dataset from Lrap knockout animals [Saba et al. DOI:10.1111/Gbb.12698]. A study in rats demonstrated that protocadherin beta 5 (Pcdhb5) is a member of a brain gene co-expression module associated with voluntary alcohol consumption [Saba et al. DOI:10.1111/gbb.12698]. In mice, selection for ethanol preference broadly affected the expression of protocadherin gene families, including those antisense to non-coding RNA hubs, within the nucleus accumbens shell [Colville et al. DOI:10.1111/gbb.12367].