Basic Information

Symbol
PCDHGA12
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily A, 12 FIB3 PCDH-GAMMA-A12 KIAA0588 CDH21 Fibroblast Cadherin FIB3 Protocadherin Gamma-A12 Fibroblast Cadherin-3 Cadherin 21 PCDH-Gamma-A12 Cadherin-21
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_003735.3
Sequence length
4854.0 nt
GC content
0.5661

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1810.80 kcal/mol
Thermodynamic ensemble
Free energy: -1891.96 kcal/mol
Frequency: 0.0000
Diversity: 1158.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((.....((((((((((((..((....((.(((.((....))))).))....)))))).)))))...)))))))))(((..(((.((((..(((.....)))(((((.((........(((((((((((((.......((((((((.((...((((....((.(((((...)))))))..))))((((((.(((((.....))))).))))))...........(((((...........)))))...((((((.((.(((.((((((.((...((((((((((((((((((....))..((((((((((((((((...((((...((((((((..(....((((((((.....))))))))....)..))).)))))(((..((.((((((....)))))).))..)))))))...))))))))).((((...))))....))))))).))))))))).))))))).((((((........))).)))))))))))..))))).))))))......((((((((.((.(((((((((((((((((((((...........)))))).)))))).......(((((....(((((.(((.......(((((((((..((((......))))..)))))))))(((((..(((((.((((...........((((....((((((.......((((((((.(((((...((((...((((....((..(((((..((.(((...((...))...))).))..)))))....)).....))))....)))).....))))).((..((((.....)))).))....(((((......)))))..)))))))).......))))))))))((((((.(((....((((((((.((((.(((.(.((((((......)))))).)))).)))))).)).))))((((.((((........)))))))).....((((.((.((.....)).)))))).((((..(((((((((.(((((((.(((.....(((((.(((.(((.((((((((((.....))).))).....(((((.((.....)))))))))))))).))).)))))))))))))))............(((((.........)))))..........(((((((((((((((.((..(((((((((((.((....)).)).........(((....((((((....))))))....))).)))))))))..)).((((((.(((........)))..))))))))))))).................((((...)))).)))))))).((((((.((.....)))))))).............)).)))))))..))))...))))))))).)))).)))))..((((........))))...............))))).......((((.((((......))))))))((((((((((((....(((((((.............(((((.....)))))....)))))))....))))))))).))).)))))))).)))))...(((((((.((((..((((((..((((((((((......)))))................((.((((((.(.......((((......))))))))))).))(((((((((((((.((((((..((((((.(((..((((((((..(((((((((((((..........((((((..((((...((((..((((.((((((((((((....))))))((((((.((.(.(((((.((.((....)))).))))).).).).))).))).....))))))))))))))...))))....))))))(((((((((.(((.((..(.((((((.(((.(((...))).))))))..((((..((((((..(((((.((((((((....)))(((((((((....)))))))))((..((((((..(.(((((((((((..(((((......(((((..(((((((((((.....(((((......))).)))))))).))))))))))....)))))..))))))).)))).)..))))))...))....))))).)))))(((.(((....))).))).(((.(((((((.((((.....))))..)))..(((((((........))))))).....)))).)))(((((.((((((.....)))))).))))).(((............)))((((.((((.((((.....)))))))))))).....(((((....)))))..........((((....))))((((...))))))))))..))))......))))..)).))).)))))))))(((((((.(.((((((((((((.(..(((((((((.(((.......))).)))))...))))..)...))))))))))))...).)))))))(((.((..((((((....))))))..))...)))...((((....)))).....((.((.(.((((((.((....)))))))).).)).))......(((....))))).))))))))).))(((((....))))).(((.......)))...)))))))).))).))))))....))))))..)))).....(((((.(((.(((...((((..((((((..(((((((.......))).....((((((((((((((((...(((((.(..(((.(((..((((........)))).(((.((((....)).)))))((((......))))....))).)))..).))))).)))))))).......((((((((((((.((((...((((.(((.((((((((.(((..(..(((......)))..)..))))).........(((((..(((.....((...((((....)))).....)).....))).)))))..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).)).)))).))))).....))))....))))..((((....)))))))))))))))).......))))))))))))..)))))).)))).))).))).)))))...))))..)))))(((((((((((((((((.((...)).).))))))))........)))))))))))))....)))))).....))).).)).)))))(((....))).......))))))))).))))))))))...)).))))))))........)))))).)))))))........))))))))))).))))))(((((.((((..........)))).))))).............................((((....)))).
Thermodynamic Ensemble Prediction
..,..,((((((....,(((((((({(({,.,|....((.(((.((....})))}.))....|)}})).)))))}}.},,})))))|{({.(((.((((,.(((.....))){((((.((........(((((((((((((.......((((((((,((..(((((,...((.(((((...})))))}..},..{(((((.(((((.....))))).))))}|,,{,,....,,}}}||,,.}}}}}...}}}.....((((((.((.(((.((((((.((...(((((((((((((((((({...})},((((((((((((((((...((((...((((((((..(....((((((((.....))))))))....)..))).)))))(((..((.((((((....)))))).))..)))))))...))))))))).((((...))))....))))))).))))))))).))))))).((((((........))).)))))))))))..))))).))))))......((((((((.((.(((((((((((((((((((((...........)))))).)))))).((,,,.((({{...,{{{{(((((,{.....(((((((((..((((......))))..))))))))}{,{,...(((((.((({...........((((....((((((.......((((((((,{,,,..{{((....,))},...|{,..(((((.,((.,{{,,,((.{{||,..,))})).,)}}}}....,,{{{{{|,||...{{{,{{.....,,.)}})}.||,|}.,}}),,)}))....(((((......)))))..)))))))).......))))))))))((((({{(((.....((((((...)))))),.,.((((((......)))))),|((({{{{|}}.}..,}},||||}||||......,{|||,,,,)}}},{((((.((.{{.....}).))))))}((((..(((((((((.(((((((.(((.....(((((.(((.{((.((((((((((.....))).))).....(((((.((,...})))))))))))))).))).)))))))))))))))...........,{,,|,...,,.{{{{,.............((((((,.(((((((.((..((((((((({{.{{....)).,|,....,,..(((....((((({....})))))....))).}))))))))..)).((((((.(((........)))..)))))))))))))...,}})},,.,.....{{{|,,,))))..,},,}}},{(((((.((.....)))))))}...........,.))}}))))))..)))}...))))))))).)))).)))))..,{((...|{{{,|}}}......{{,....||},,.}},.....||{,.(((({{{...|||}|||||({(((((((((....(((((((.............(((((.....)))))....)))))))....))))))))).)},.})),)),),)})))},,|{{||||||{{|,.{{{{{{..{{{{{(((((......)))))..,,,,,,,,......|{,((((({.,.......((((......))))})))))).},(((((({({{(((.((((((..((((((.(((..((((((((..(((((((((((((..........((((((..((((.,.((((..((((.((((((((((({....}))))){(((((.((.{.(((((.{{{((....)))).))))).}.).).))),,)).....))))))))))))))...))))....))))))(((((((((.(((.((..(.(((,({{{{,,(((,..}}}.})))}}..((({..(((({(,,(((((.((((({((....|||(((((((((....)))))))))({..{{{{{|,,|.(((((((((((.,(((((..,,..{{{{|,((((((((((((.....{{(((......)}),)))))))).)))))),))}....))))).,))))))).)))).,.,)))))).,,)}....))))).)))))(((.(((....))).))).(((.(((((((.((((.....))))..)))..(((((((........))))))}.,...)))).)))(((((.((((((.....)))))).))))).||,.,......,...}}}||||.|||,|||||..,,.}})}}}})))})}....(((((....)))))...,,{,,.,{{{{....)))}||||,}|}|||||}}}},,)))}......))))..)).))).))))))))){({({((|{.((((((((((((.(..((({(((((.(((.......))).))))),,,))}}..}.}.)))))))))))).,,),)))))||((,.{(|,((((((....))))))..)),..,}}...((((....)))).....((.((.(.((((((.((....)))))))).).)),)}......(((....))))).))))))))).))(((((....))))).(((.......)))...)))))))).))).))))))....))))))..)))||...,({(((,(((((((.{.{{{{,.{(((((,.{(((({(,{{((.{{{({.,,,,,,.((((((((,{{,...(((((..(((..((((({(((,..,(({.....)}},}.,.))).}.)))))...((((......)))))))))))),}).}))))))).,|||,,,,...,}},{{{(((((((((.{(({,..{(((.,{{{((,,{,{||.|||.{..|,||||...|||,{||.|}}|||{{.{,...(({{{..(({,....,,...((({....||||,..{{{......}))}})))),,}},(((((((..((.((({{,{((,((,,..((.....((((((((((..(({..((((((.....(({.,..(((((((((((...(.(((((((((.(((..(((((((((((((((.{...(((....((((....)))).....))).....))))).....((((....)))){((((((.((((((..(({(((((((((.....,......((((.......))))......,,.....)))))))))..,....(((....))|((({,,.{{||,,,.{{{{{{{......||{||{.......,(((((.((((((((.{({.........,})))).....)))))))))(((((((....))))))){((((((...............{((((....,...((((((,.,,,.,,.,((((((((((((({(((.((((,(((((,.(((..((({((..((((.(((((.(({,,,(({,,,...{{{((,,,....,,,{{,,,,,..||{,{{|{..,,.,....},}))}}}.},}.{{({...,}}}.......,|||,|{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||}},})))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.,((....}}},..,|....,||..}},})}.}}}...}}},,.})).})))),}))))))))}.))}(((......))){{{(((,(((.((((....))))))))))))),,........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))}||}((((((((,,((..({{(,||,)}}}..,)}),,.,..,...{(((((...............)))))|(((((((({{({,........((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).))))})))))))),.)))))))).)}))))}}.)))))))||}))..))))....)}.)))))))))))))))))(((((((.((.((((((((.((..(((((.(((({..........(((((((((((((......(((((....)))))...))))))))},)))).(((((....)))))...})))).)),,))...)))).)))))))).))))...)))))))))).)))))).,.))))))).....,}))....))))))))).)))...)),}))))))).,...,}}},}))))},})))).,)}..))))))).))))))))))})}..}}}))},.,,{||||.,((({|,,,}}}|||||}}}}}}}}}}}}}.}|||||,}.}}}}..)))))).)})}.).)})).}))))},,,)))),.)))))||((((({,{{({(((({(({,,||,|,|}}||}}},....,..))))})))))})),,,,,}}))),}},.}})}),}}.)))}){{{....))).......))))))))).))))))))))...,,.))))))))........))))))}}))))))........))))))))))).))),)).{(({.(({{..........},}}.})}}||||||,,,.,...,,,,,...........{{{{....))},.

Transcripts

ID Sequence Length GC content
AAGAUUGUGCAGUAAUUGGUUAGGACUCUGAGCGCCGCUGUUCACCAAU… 4854 nt 0.5661
AAGAUUGUGCAGUAAUUGGUUAGGACUCUGAGCGCCGCUGUUCACCAAU… 2716 nt 0.5611
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans delineated age-associated mRNA expression patterns in peripheral blood and established a robust age prediction model using 34 mRNA markers, including the PCDHGA12 which was identified as a differentially expressed gene (DEG) and a member of the protocadherin gamma (PCDHG) gene family showing differential expression between young and elderly individuals [Liao et al. DOI:10.1016/J.Fsigen.2025.103373]. The elastic net model constructed with these markers demonstrated strong performance for age estimation, achieving a mean absolute error (MAE) of 6.72 years on the test set.