Basic Information

Symbol
PCDHGA5
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily A, 5 PCDH-GAMMA-A5 CDH-GAMMA-A5 ME3 Protocadherin Gamma-A5 Cadherin ME3 PCDH-Gamma-A5
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Chronological age estimation

MANE select

Transcript ID
NM_018918.3
Sequence length
4767.0 nt
GC content
0.5555

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1724.70 kcal/mol
Thermodynamic ensemble
Free energy: -1807.34 kcal/mol
Frequency: 0.0000
Diversity: 1444.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........(((((((((((...(((((((((((((........((((((((......(((..(.(((...((((((((((.((.(((........))).(((((((....................)))))))...........))))))).))))).))).)..)))...((.(....).)))))))))).((((((((.((((((.(((((((...((.((((.(((((((((..(((((.((.....((((.((...((((((((((.....((((((((((.......))))))))))..(((......)))......((.((((....)))).))))).))))))))).)))))).)))))))))))))).)))).)).)))))..((((.((((..((((((((((....))))......)))))))))).)))).....)).)))))).)))....))))).))))))))((((........))))))))).)))....((((....))))..))))))))((.((((((.((((.......))))....(((((......))))).((((((..((((((................((....))((((((((.....)))..)))))..(((.((((((((((.(.(((((.(.....(((((((((((((((..((((.(((......(((.(((....))).)))......))).)))).((((....(((.(((((((((((((((((...(((......((((.(...((((.((((....((.....))...))))))))...).))))......)))....)))))))))).))...)))).).))).))))...((((...((((((.(((((..........((((((((((.((((.(((((((.(((.((.......)).))))))))))))))............(((((...((((..(((((((((......((((((.......(((((.......)))))......)))))).((((.(((((..(.............)..))))))))).............(((((((....))..)))))))))..))))))))).))))).)))).)))))).)))))..)))))).((((((..((((((.((((((......((.(((........)))))......)))))).)))))).......((((((.......(((((...)))))...)))))).....))))))....))))......)))))))))))))))...(((.(((.((((.((..((((.(..(((((...(((((.((....(((((((((((((((((.....)))))...........(((((((.(((.((((((((((.......(((......))).........(((((.(((...((....)).....(((((((...(((.........)))....)))).))).))).)))))................................((((((((................))))))))......))))))))))..)))....((((..(((..(((.......)))))).)))).....)))))))((((((.....))))))((((((((..((((.....(((....))).......))))..))))))))...(((((..((.((....))))..)))))((((....((((((....))))))..))))(((((((((((((.....)))))............)))))))).((((....((((((((((((.((((.((((((((((.....(((...(((((((.((.(((...(((((((((....)))))))))(((((((((.(((.(((.(((((((..(((((.....((((((..((((((((((.....((((((......)))))).))))).)))))))))))...)))))..)))))))..))).((((((...))))))..))))))))))))(((((.((((.((.(((((((......((((((((..(((((((.(((((((((.((((.((((.((((((..((..(((..((((((((......(((((((.......))))))).((((...))))......))))))))..)))..)).((((........))))...(((((.......)))))(((((((((....))))).))))..((((((.(((((.(((...((((.....((((((((((((((((((((..(.(((.(((((.((((((.((((.(((((((....(((...))))))))))))))...)))))).))(((.((((..(.(((((((..((.((((.(((((...((((((((((.........))))))........))))....(.(((((.(((....))).))))).)))))))))..).))..))))))))..))))..)))..(((.((((((.((.((((((((((..(((.((............)).))).))))))..((((.(((.....)))..))))......)).)).)).)))))).)))))))))...)..))))))))))))..........))))))))...(((.....)))......))))...))).))).)).)))))).)))))).)))))))).)))))).))).))).))).)..))))........((((((((((((.((((...((((.(((.((((((((.(((..(..(((......)))..)..))))).........(((((..(((.....((...((((....)))).....)).....))).)))))..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).)).)))).))))).....))))....))))..((((....))))))))))))))))...........)))).......))))))).))..)))).)))))......)))..)).))))))))))))))).(((((((((((((((..(((.......)))))))..)))).)))))))...))))))))).))).))))).))))..))))...............)))))))))))))).))).))))).))..).)))).)).))))))))))..)))))).).))).))))))).))).(((.....)))..............)))))).))))))...................)))))).)).....
Thermodynamic Ensemble Prediction
......,.(((((((({{{,,{({,..((((((((......,.((((((((.{,...((({..,(((...((((((((((.((.(((........))).(((((((....................}))))))...........))))))),})))).},).}..}))..}||}...}},...)))))))),((((((((.((((((.(((((((..,((.{(((.(((((((((..(((((.{,..,,.((((.((...((((((((((..,({((((((((((.......))))))))}}.}|||,.....}||,{{...||,||{(,,,.}}}),))))).))))))))).))))})})))))))))))))).))))})).)))))..{{{|,((((..(((((({(((....))}}.,,...)))))))))).,}},.....)).)))))).)))....))))).))))))))||{{....,,,,|}},,||}}}}}}..,.,,{{.....,,)}}))))}})}})}|||,,,.,{{,........,,,....(((((......))))).((((((,,({((((,,,{((,,,{((,.,(({({{,{|{(((((((.....}))..})))}..{{{,(((({({(((.(.(((((,({{{,,({{{,{|||{{{((({{(((({(((..,{{{(((,(({....})).)})},..,,))}.||},.(((,....,|.}}|||||||||,|||||{,,.{{{.,,...{{{{,{,..{{{(,{{{|,|,|{,.,..,,|,,,||||||||.,,|{||||,,..,{||.....|))))||}|||}|,||}}})|}..}}|||||||{,(((,..,,,,,,,|||{{.,,||,..,,{(((({((({.((((.(((((({{(((.((.......)).))))))))))))))}}}..|,,..{{({,,|,,.{{{,,|||{|||,,,....{{|,......,}...{{((({{.....}}}))}||.....,}}},((((.{{(({..{,,{....},..,,)}}))}}})))).............{{{((((,{{,{{{.|||||||||,.||}}}})),.}}||||||,|{|||||},||||},,||||||{{({(((..,{{{{{,(((({(..,.,,((,(((........}}||||,,,,,|||}}},|}}}}|(((((.(((({{{,.,{{,.,,,{{{{{{|||{(({|{{|{{{,.,,(((((....}))))..,,|,||||,,|||||}|||...,((|(|{,{{{{,({,{((({,,..(((,....,|||,......,||||{{{{{{{{(((((.....))))},{{{.......,}}||||.||||,||||||{||},||||.({{......}}}.........{{{{|||,.,,,|{,...,}||,..{{||,.,})},.}},,,,,.....,,..,{{||,{({.{{{.,{{,..................,,.,|||,.},,,,.,,,,.((((((((((..........|(({,,,.}}}}.,,}},)))))))))).,},||||..,({,,{((,,,....)))}}}.))).,,...,,..,))}}}}||...|||}}}|||||||({{..{|||..,..|||,...}}},,,,,,,)}}}..|||}||}},,,{((((..((.((....))))..)))))}}})}),,)))}}}}},)}))))}}|||{{(((((((((((((.....}))))}...........}))))))).}},}|||,(((({(|{{(((..{{......||,|}|.|.|||{(((((.(((((.,........(((((((((....)))))))))(((((({{..(((((((.(((((((.,(((((.....((((((..((((((((({..,..{(((((......))))))}))))).)))))))))))...))))).,)))))))..,.)}))))).,)))),))....))))).)))))|,,|||||||,||.{||||||,|||||{{{,((((....,)})).,}||(((((((((.{,,,..,}||||}}{},..||}||||,((({{,..,|((({{{|},..,,.)))))}),|||||,..,,..,))))))}))},},.,}}|||,.((((........))))..,|||||,},,}},||}||{({,,,.,,.,)}))})),,{((((((((((.(((((.(((...((((.....((((((((((((((((((((..{.(((,(((({.((((((.{(({.(((((((,,..(({,..}}))))))))}))),..)))))),))|||.((((..(.(((((((..((,((((.(((((...{,({((((((.........))))))........)})),...{.(((((,{((....))).)))))..)))))))),.).))..))))))))..))))..}}}.,(((.((((({.((.((((((((((..(((,((......,,,,},}}.}}}.))))))..((((.({,.....,)},.))))......)).)).)).)))))).))))))))}...,..))))))))))))..........))))))))...(({..,,,)}}......))))...))).))).)).)))))},)))))}.,}|||||,.,,)))),,||{||}|{|,|{(((((,{,.,,...(((((((((((({(((.({{.,,,..}}.|.})){||...((((..((((.({...{((((((({.((({{.{,.{{((((,.,(((..........((((....)))){,,(((....,,||,||||||..((.(((((((..((.((({{,,((,((,,.,((.....((((((((((..(({..((((((.....(({.,..(((((((((((...(.(((((((((.(((..(((((((((((((((.{...(((....((((....)))).....))).....))))).....((((....)))){((((((.((((((..(({(((((((((.....,......((((.......))))......,,.....)))))))))..,....(((....))|((({,,.{{||,,,.{{{{{{{......||{||{........(((((.((((((((.{({.........,})))).....)))))))))(((((((....))))))){((((((...............{((((....,...((((((,.,,,.,,.,((((((((((((({(((.((((,(((((,.(((..((({((..((((.(((((.(({,,,(({,,,...{{{((,,,....,,,{{,,,,,..||{,{{|{..,,.,....},}))}}}.},}.{{({...,}}}.......,|||,|{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||}},})))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.,((....}}},..,|....,||..}},})}.}}}...}}},,.})).})))),}))))))))}.))}(((......))){{{(((,(((.((((....))))))))))))),,........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))}||}((((((((,,((..({{(,||,)}}}..,)}),,.,..,...{(((((...............)))))|(((((((({{({,........((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).))))})))))))),.)))))))).)}))))}}.)))))))||}))..))))....)}.)))))))))))))))))(((((((.((.((((((((.((..(((((.(((({..........(((((((((((((......(((((....)))))...))))))))},)))).(((((....)))))...})))).)),,))...)))).)))))))).))))...)))))))))).)))))).,.))))))).....,}))....))))))))).)))...)),}))))))).,...,}}}.,))))},})))).,)}..))))))).)){{{||{,.....,..})))..,{{{{{|.,{{{,||||,}}||{({{|||,,||......}|,,|}}}}......)))))),),)}.},}))))))}}....))))}.,)))))|||||{{|||||{{({({(({,,||,|,|}}|||}},....,,.))))}))))),))),))))))))}...)).)))).))))..)})}...)))}})))))))))..,.,,|)}||.))))}},.))}))}}},}},}},})))})}.)))))))))),,,))))).).)))}))))))).)))},|}),}}}..,,,.,,,})},,.,,)))))).}))})),..................}||||,.,.,,,..

Transcripts

ID Sequence Length GC content
GACCCGACUCUGCUCCCUCCAUACUAAACACACAGACCAGACAAGCUCC… 4767 nt 0.5555
GACCCGACUCUGCUCCCUCCAUACUAAACACACAGACCAGACAAGCUCC… 3622 nt 0.4978
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that selection for ethanol preference significantly affected the expression of numerous cell adhesion molecules, including protocadherins, with the PCDHGA5 being part of a family broadly affected by selection in the nucleus accumbens shell [Colville et al. DOI:10.1111/Gbb.12367]. In humans, a study analyzing peripheral blood mRNA identified multiple protocadherin gamma family members as differentially expressed with age, establishing a robust age prediction model with a mean absolute error of 6.72 years using 34 mRNA markers [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].