Basic Information

Symbol
PCDHGA6
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily A, 6 PCDH-GAMMA-A6 Protocadherin Gamma-A6 PCDH-Gamma-A6
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Drug abuse diagnoses

MANE select

Transcript ID
NM_018919.3
Sequence length
4794.0 nt
GC content
0.5561

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1758.20 kcal/mol
Thermodynamic ensemble
Free energy: -1841.36 kcal/mol
Frequency: 0.0000
Diversity: 1252.99
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.((((((((..((((((.(((....((((.(((..((..(((.((.((.(((..........)))..))))))))).))).)))).))))))))).(((((((....((((....(((.((((((((.....(((....)))))))))))..((((((.......))))))..........((((....))))(((((....))))).....)))...))))...)))))))((((((((.((((((((((..(((((((....)))))))((((......)))).(((((.((((((((((((.......)))))))((.(.(((......))).).))..))))).)))))))))))))))))).)))))..((((.(......).))))...)).)))))).)))))................((((((.......((.((((((((((((.(((((..((.....))))))).))....)))))))))).))((((........)))).((((((((((((((.......))))))).((((..((((.....((((((((.....((((.((((.(((((((((.....)))))))))...........(((.(..((.(((((((......((((((((((((...((((((((((.(((((((.((..(((.....((((....)))))))..)))))).))).))))..)))))).))))))......)))))).......(((........))))))))))))..).)))((((....((((((((..((.(((....))).)).))))))))....)))).((((((((.......(((((.(((...(((((((((..((((((((.((((..((.((.((((((..............)))))))))).))))((((.(.(((.((..........)).)))).))))((((....))))((((((...))))))...))))))))((((((((...(((((..(((....((((((((((((.((((........)))))))))))..(((.....))).((((.((.((.((((........)))).))..)).))))...(((((((((((....((((.((((((((.((((....(((((((((..(((..(((((((((((......((((........((((((.(((((.((((..(((((.((((((((((((....((((....)))))))))))))........(((((..(((((((........(((..((........))..)))(((..((((.....)))).)))...))))))).(((((....((((.(((.......))).......(((((....((((((.....))))))......)))))..))))))))).)))))..))).)))))..))))...))))).))).)))...)))).......))))))))..(((........)))........(((.....)))...)))..))).)))))...))))...))))...)))))))).))))..)))))..........((((((((((((.((((((((((((.((....(((....(((.(((.(......).))).)))))))).)))).)).)))))).........))))))))))))))))))....(((((..........))))).)))))....))).))))).))))))))........(((((((((....)).)))))))))))))).)).))))))))(((((((((((......)).((..(((((((((..((((((..((((.((.(((....((...((.(((((((.((((((.(((((((..((.......(((((((((....)))))))))..(((..((((....))))..))).((((((...)).)))))).))))).)))))).))))))))))).....(((((((...((...((((.....)))).))..))))))).....))....))).)).))))))))))..)))).)))))..))((..((((((((...(((((((((((.....)))).....(((((((((........))))))).)).......((.(((((.((((((.....)))))).))))).))((((((.......))))))(((......))).(((.((.(((..((((((...(((......((((......))))....)))...)))))).))))).))).....)))))))...((((((.((((((.(((((((((((((((...)).)))))))))...((((.(((.(((((((((....(((.((.(((((.(((((..((((.(((((((....(((.(((((((...(((((.(((......((.((((((.........)))))))).........(((((......)))))...........))).)))))..))))))).))).((((.((.....)).))))..........)))))))((((((......(((((.....)))))......)))))).....))))..))).))))))))).))).....(((((((.(((((.((((..((((..(..((((((((.....((((((...(((((..(((..((((((((((.(.(((.....))).).).))).).)))))...((((......))))))))))))(((.((((.((...)).)))).)))..))))))..))))))))..)..))))..)))).)........)))).)))))))..))))))))).)))...))))...(((((..(((.....((...((((....)))).....)).....))).))))).)))).))))))))))))))))))))..))...(((...........)))(((((.(((((((((((((..(((.(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...)))))................)))))).)))........)))))))))).......))))))))..)))))))))))))))))(((((((((((............(((((((.((((.((((...((((((((((.(((......((((((........)))))))).).)).).)).))))).)))))))).)))))))(((((((((((((((.((...)).).))))))))........))))))..)))))))).))).)))).))))...))))))))(((((.(((.((....................)).)))...)))))........((.((......))))..)))).))))........(((((...)))))((((.((((..........)))).))))........))))))).............)))))).........
Thermodynamic Ensemble Prediction
,((((,(.{{((({..(((({{((((....((((.(((..((,{{..,((,({,(((,...,,,|,,|||...,|})}}}}.))).)))).))))))))).{((({(({{.,{(((,{,,{(({(((((({{.....(((....})}}})}})},}}||||||.......)}))))..........((((....))))(((((....)))))...,{{.,.,.,))),||}}}||||((((({({.((((((((((..(((((((....)))))))((((......)))).(((((.((((((((((((.......)))))))|(.{.(((......))).}.)}..})))).)))))))))))))))}}).)))))}.|||{.|,|,.,|},}}}|.,,||.,|||||||||},|||,,,,,},,,{{(((,,{{{{({{{..((|(,((((((((((,(((((({((..{{.||||||}.}},,,,)))))))))},|||{|{.|{{{,..|,{{,,|||{{,(((((((.......}))))))}}|||}.||||}}}}}||||||,,....,,.,,..(((.(((((((((.....)))))))))..}}}....,,{{{,{,,{{{{(({{{{...,.,||||||||{{{{..,||||||{{{,.,((((((.,,{(((......||||.}}}))),,,,..||||}|,|||.,}||{|{|||||,}|||||,,,,,..,))},.{{{,.,{|||{,..{{.||,}},}}}))}|}),},}|||{,...((((((((..((.(({....))).)).))))))))....||||,.{{,||||(({{{{,{((,..,,,,..|,||||||,..,,{{((({,{{{{..||,{{,(({,,{,,..,|,.,....})))}}}}}}}.}|||{|||.|.|{,,|||||,,,....}},||||.}}})))|,.,.,}}|,{(((((...)))))),,,}}}}))}||{||||||}}.,||||},|}|}}},.,,,,(((((({{((((........))))))))))}{{(((.{,,,((((({{{{{..{({(((,..,,,..{|||,,||.,(((((.,(((((((((....))))))))}.,))))))||,||||..(((((((((.(((((.,(((({{,{(,({((,{{........{((.(((((((,({,...,,,,.{((((....(((((((((....((((....)))))))))))))....))))),.)))))))..})}.,},,,.}}})}}}.,,,}}}}..},))}||{,.((((.....)))).))}.))))).))))))))),||||||},|||,||||||{}},,},.,,||{|||{{.(({(((.....}}))))....}})}||}..{{{{{(((((({((,.....{{{,|........,|||,|,((((((((((.(((.......))).)))))..{((........,,}........))))).|.||}..,{{|,,,.{{|||{..||,|||...,||,.....,.,,},...,},...}}}.........(((((((((((((.((((((((((((.,{....(((..,.{,{,{{|.|.....,),},,.)}})}},..}))).}).)))))).........)))))))))))))...{{{{{.(((((..........)))))|))}}{{{{{{|.{{|{{|{||||,|||{{{{....,,|||||||.,..}}.},|||||}|}||,,.||})|),))))|((((((((((......||.((..(((((((((..(((((,.,((((.((.(({...{({...{(.(((((((.((((((.(((((((..,,,......(((((((((....)))))))))..(((..((((....))))..))).((((((...)),,))))).))))).)))))).))))))))))}{{{.,(((((((...{{...((((.....)))).})..))))))).,,,}},}}}.}}),)).))))))))))..)))).)))))..)){(.,((((((((...(((((((((((.....))))...{.(((((((((........))))))).)}.......{(.(((((.((((((.....)))))).))))).)}((((((.......))))))(((......))).(((.((.(((..((((((..,(((..,...((((......))))....))),},)))))).))))).))).....)))))))...((((((.((((((.(((((((((((((({...,}.)))))))))...((((.(((.(((((((((....(((.((.(((((.(((((..((((.(((((((....(((.(((((((...(((((.(((......{({((((((.........)))))},......,}}}(((((......)))))....,......})).)))))..))))))).))).((((.((.....}),))))..........)))))))((((((......(((((.....)))))......)))))).....))))..))).))))))))).))).....(((((((.(({,{.((((,.((((..{..((((((((...,,((((((...(((((..{{(..{(((({((({..,{{{.....)}},}.,.))).}.)))))...((((......)))))))})))}|||.{{{|,||..,)),)))).)}|,,|}}})),,))))))))..}..)))).,)))).}.,,,...,)))).)))))))..))))))))).)))...))))...(((((..(({.....,....((((....))))...,,|,.....))),))))).)))).)))))))))))))))))))).,))...{||...........}}}((((,,(((((((((((((..(((.(((((((((((...(.(((((((((.(((..(((((((((((((((.{...(((....((((....)))).....))).....))))).....((((....)))){((((((.((((((..(({(((((((((.....,......((((.......))))......,,.....)))))))))..,....(((....))|((({,,.{{||,,,.{{{{{{{......||{||{........(((((.((((((((.{({.........,})))).....)))))))))(((((((....))))))){((((((...............{((((....,...((((((,.,,,.,,.,((((((((((((({(((.((((,(((((,.(((..((({((..((((.(((((.(({,,,(({,,,...{{{((,,,....,,,{{,,,,,..||{,{{|{..,,.,....},}))}}}.},}.{{({...,}}}.......,|||,|{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||}},})))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.,((....}}},..,|....,||..}},})}.}}}...}}},,.})).})))),}))))))))}.))}(((......))){{{(((,(((.((((....))))))))))))),,........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))}||}((((((((,,((..({{(,||,)}}}..,)}),,.,..,...{(((((...............)))))|(((((((({{({,........((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).))))})))))))),.)))))))).)}))))}}.)))))))||}))..))))....}}.)))))))))))))))))(((((((.((.((((((((.((..(((((.(((({,.........(((((((((((((......(((((....)))))...))))))))},)))).(((((....)))))...})))).)),,))...)))).)))))))).))))...)))))))))).))))))...)))))}...............}))))).)))........)))))))))}.....,}))))))))..))))))))||},,})),)))))))}}||}})}...}}},.(((((((.((((.((((...((((({({{,..{,{,...,((((((........)))))),).}.)).).)).))))).)))))))).)))))))|||,||.}|||}|(({(({{{{|{|,|,,|||,},,...},,))))}})))).)))))),)))))}}|}||||||||||,,,,(((((.(((.((................,...)).)))...)))))........)))))),}}}},,}}...........}}}}))))}|,||}}.,,)),{{{,.,,,|..........}},}.})))}}|,.,}}}}}}},,........,,,}}}}}|||....)))}.

Transcripts

ID Sequence Length GC content
AAGUUACAUCCUCCAACAACAAAGCAAAUUAGACGGGAAAGCAGGAAAG… 4794 nt 0.5561
AAGUUACAUCCUCCAACAACAAAGCAAAUUAGACGGGAAAGCAGGAAAG… 5755 nt 0.4608
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that selection for ethanol preference significantly affected the expression of protocadherin genes, including Pcdhga6, within the nucleus accumbens shell, where it was part of a family broadly influenced by selection and antisense to a non-coding RNA hub [Colville et al. DOI:10.1111/Gbb.12367]. In humans, analysis of peripheral blood mRNA identified PCDHGA6 as a member of the protocadherin gamma family that was differentially expressed between young and elderly individuals, contributing to age-associated transcriptional patterns [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].