Basic Information

Symbol
PCDHGB1
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily B, 1 PCDH-GAMMA-B1 Protocadherin Gamma-B1 Protocadherin Gamma Subfamily B, 1, Isoform 2 PCDH-Gamma-B1
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses Chronological age estimation

MANE select

Transcript ID
NM_018922.3
Sequence length
4748.0 nt
GC content
0.5501

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1710.10 kcal/mol
Thermodynamic ensemble
Free energy: -1791.94 kcal/mol
Frequency: 0.0000
Diversity: 1431.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((((.((((.((.((((((....).)))))..)).))))...((((.....(((....))).....))))...(((.((((((.(((....)))..))))))...)))...........(((((((((((((......(((((...((((((((.((((..(((.((((......((((.....))))((((..((((((((.(((((((...(((((((((((((.....)))).)))))........))))...)))..(((((.......))))).)))).)))))))).)))).(((...(((((..........(((((((((.((((((.......)))))).(((.((((((((((......((((((.(((.(((.((((...(.((((((..((((.......))))........((((((((((....)))..((((((((((....(((((..(((((((.......((.(((((((((((((((((((((((((.................)))))).)))))((......))..(((((..(((((((........))))))))))))..((((((.........))))))..(((((.......))))).))))))))).))))).))........(((((....................((((((((.....((((...))))..((((.((.....(((((((....)))))))...)).))))))))))))......((((((....((((((((((((.....)).))))(((((....)))))..))))))(((((((((...((((.....(..((((((((((....(((((((((((((((........((((((...((.(((..(............)..))).))....))))))..(((.(((((.(((((((........((.((((((((.................)))))))).)).....(((((((..(((..(.((((((((....(((((((....((((................)).))))))))))))))))).)..)))..)))((((.(.(.((((..(((.....((((((((..(((.(((((...((((((((((...........((((..(((((.((((((((((....)).).)))...)))).)))))))))(((.(((((.(((.......)))))))))))....................((((....(((((((((.....((((((((....))))))))....(((((....)))))......)))))))))..))))..))).)))))))))))))))...(((((.(((((....(((..((.((.....(((......)))....))...))..)))...)))))...)))))...)))))))).....))).)))))).)))).((((.(((((..((.(((.....((((........)))).......))).))....))))).))))...........(((((.....((((....)))))))))((((...))))..)))).((....)).(((((.....)))))....)))))).).))))).)))))))))))).))))))....))))))))))..)..))))...))))))))).((((((((..((..(((....))))).)))))))).....))))))(((((((((((((.(.....(((....)))((((...))))...).)).))))))).))))))))))))))))...........((((...(((((...))))).))))(((((((....))))))).....)))))..))))).))))).)))))))(((..(((((((((...)).)))))))))).((((((((((.(.(((((((((((((..(((((((..(((.(((((.........((((.((((((((....)))))))).))))))))))))(((((((((.....)))))))))((((((((((((((.(((..((((((....)))))).((((((((.((.(((((...........)))))(((.(((((.((((((...........((((.....))))..(((((........))))).....((((((.(((((((......((((((((((...((((....(((.((((..(((...((((.....(((((((..........(((.(((......((((.((((.........))))))))......))).)))))))))))))))))....)))))))..)))))))..)))))))...)))))))........((((((((((((.(..(((..................)))..)))))))((((((......)))))).............(((((....(((......)))...)))))....))))))((.(((((.(((..((((.......)))).....))))))))))......................(((.((((...(((((((((.(.((((..((((((..(((((((.......))).....((((((((((((((((...(((((.(..(((.(((..((((........)))).(((.((((....)).)))))((((......))))....))).)))..).))))).)))))))).......((((((((((((.((((...((((.(((.((((((((.(((..(..(((......)))..)..))))).........(((((..(((.....((...((((....)))).....)).....))).)))))..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).)).)))).))))).....))))....))))..((((....)))))))))))))))).......))))))))))))..)))))).)))).).)))).).))))....)))).))))))))))))))))))))..))))))))))))).))))))))))).)).))))..))))))).))))))))))))).))))))))))).)))))).)...)))))))..))).)))))).......))))....)))))).)))........))))))))).))))).))))))))))..))))..)))..))))).)))))...........))))))))))))).))))))..............((((....)))).
Thermodynamic Ensemble Prediction
{,......||{(((((.((((.((.((((({....}.)))))..)).))))...((((.....(((....))).....))))....{{,{((({{,{,(((,({{,...{((({{{,,||......,,..}|||||||,,|||,},,.||,{{{{{{,{{{.{,||}|,||,,,(((((((({{,...({.((.{(((({((((..((((((((.((((.(({,,{{(.((((({(((.....,))).)))))...}}.},},,....,.,.,(((((.......))))).)))).)))))))).}}}}.,(((,,{(({{..,,|.}}}}((({(((((,.,{{{{....{((((|||.,{{||,|((({.....,,.......(({{(({(,((((({.{{{(((((({..((({{(({,.{{(,{{{{{{{{.,(((,((,,(,...,}|{.((((({((({....{{{{,..((({{{,....,|,((.(((((((((((((((((((((((((.,,.........,.,}.))))}|.))))){,......))..(((((..(((((((.,....}.))))))))))))..((((((.........))))))..(((((.......))))).)))))))))},)))).)).,}}..,,}}|||,,..,,,,...}}}..}}}}||||,|||..,{{,{({.,{{,(|{{((|,........(((((((....)))))))....|{|||.,,,)))),.,,}},|{|||{,,.,||{{{,||||||.,,,.}}.}}})|||||,..,))))),,)))))|(((((((((...((((....{(.,((((((((((....(((((((((((((((........((((((...((.(((..|,.|,........}..))).)).,..})))))..(((.(((((.(((((({.,,,...,((.((((((((...{{.......},...)))))))).}}...,,{{{{({{..(((..(.((((((((....(((((((....((((.............,},)).))))))))))))))))).}..)))..}}|((((.||(.((({,.(((.....((((((({..(((.(((((...((((((((((.........,|{{{,..({(((.({({{(({{{....)).}.)))...)))).))))),,..(((.((((({{((.......))))))))))).....,,.,,,......}.}{(((....(((((((({.....((((((((....))))))))....(((((....)))))......,))))))))..)))}..))),,))))))))))))))...(((((.(((((....(((,.((.,,..,..(((......)))....,,...))..)))...|))))...))))),,,}))))))).....))).))))}),)))),((((.(((((..((.(((..{..((((........)))).......))).))....))))).))))...........(((((.....((((....)))))))))((((...)))).,)))).{{....)).(((((.....)))))....)))))}.}.))))).)))))))))))).))))))....)))))))))).,,}}))))...))))))))).((((((((..((..(((....))))).))))))))..,,.)))))}|{,|{{|||(((({(..,,.((({{{.,|,((((...||||{,.|,||.|}}}|||{||||||}||||},,}).,...,,...,|||{...(((({...})))).)))),((((((....))))))),.,..,}))}..)))))).,,))})}),,))|||},|,{,|||||}..||,,}))))}|||{((((((((((.(.(((((((((((((..((((((({{{((.(((((.,.....,,((((.((((((((....)))))))).)))))))))))}|((((((((.....)))))))}|((((({((((((((|(((.,{({{({|||.}}}))}}||||||||,{.,((|(|,,,|}},|,..,,,,|{{{.(((((.((((((.{{...,{{,.((((.....)))),|||(((...,,,,,|,|||{{,{.,,{{,|,|||{{{||||...((((({((((...((((....{{(.(((({,(((...((((,....(((((((,,........(((,((({,,,..,,{|,||||,..,,,.,,|}||}}},..,,,,)||,|}}}}))))))))))}}....}})}))}..))))}}}..})))))),..||||||,....,..,(({(({((((((.,..,((|...,,,,.,,,.....,))).,}}}}}},.,{{({,..,||}||||,......,,.,...{{{{{....|||...,,,}}),,,))}}}....}}}}}}{{.(((({{(((..((((.......)))).....)))))))),,.....|,....||,....,...|||.{,||...{{|||||||,|.{{{{.,{(((((..{(({({(,{{((.({{({.,,,{,,,((((((((,{{{...(((((..(((..((((({(((,..,(({.....)}},}.,.))).}.)))))...((((......)))))))))))),}}.})}))))).,|||,},,.,.},,.((((((((((((.|(({,..|{{{.,||||{|||,|||.|||,|,.,,|}},...|||||||.,,||{{((,({...((({{..{({...,,{{.,.((((....})))...{{{......}))}})))).,}}}||{((((..{(,(((,{,,||.|||..,{{,....{{{{{{||||,,|||..{{((((,,,.,({{.,..(({((((((((.,.{.(((((((((.(((..(((((((((((((((.{...(({....((((....)))).....))).....))))).....((((....)))){{||||(.{{((({..{{{(((((((((.....,......((((.......))))......|,.....)))))))))..,....{{{....)))||||||,|||}.||.((((({,...,,.{|{|||.....,,}|||||.{{((((({.,{{,.,......,,}}}}...,,)})})))))(((((((....))))))),{{((((,,.,,,,........,{{{(,,,,{,,,((((((,,{{{,{{,{{((((((((({{{{{((.({{({((({{,.(((..((({((,.((((.(((((.((,.,,(({,,,...{{{((,,,...,,,,{{,,,,,..||{,{(|{..,,.,....,,}))}}}.}}}.{{({...,}}}.......,|||,{{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||,,,,)))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.{{(....}}},..,|....,||..}},})}.}}}...)}},,.})).))))),})))))))),,)),|||.....,))){{{{{(,(((.((({....))))))}))))))}}...,....))))))))},))),}))).)))),.))))))))})))),...(((((((....)))))))..,..})))}|||||||{({{{(((.,((,,(,,{}}}})}}),,,}})}},},,,..,((((((...............))))))|((((({{,,(,,......,,((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..)))))))){{{,,,.})),|||.((.(((((((.((((((...))))))))))))).)).}))}|)))))))}|.}}))))}},}}}|||||.||||||||||}|,,)))}....,,.)}}))))))))))))))(((((((.((.((((((((.((..{{({{.{({{,|,.,,.,,..(((((((((((((......(((((....)))))...))))))))},)))).(((((....}))))...,}}}}.}},.}}...)))).)))))))).))))...))}))))))).))))))...))))))).....}))),...)))))))}).)}}...}},,))))))),},,,}},,}}))))}.})))),})}..))))))),)))})))}}}},}.}.,,))}}.,,{||||.,((({,,,,}}}|||||}}}}}}}}}}}}}.}|||||,}.}}}}..)))))).)})}.).)))).),)))}.,,,)))).)))))))))))))))))))),|||||}})}}}|))})}|,))))))).)),))))}.))))))).))))))))))))).))))))))))).)))),.})))}),}))},,.,,}}))))))}}.))}}....,})))))))))))))}..},,.)}))))))).}..}}}))},,},,||||{...}})}|{({..,,,|,,..........,..)))))}}},}}}},)}}}}}..............||{{....)}},.

Transcripts

ID Sequence Length GC content
GCCUUCCUGCUUUGUCCGGUGCACUGAGCACAGACGCUGCUCCUGUUCA… 4748 nt 0.5501
AUGCAGAGAGCCAGAGAAGCCGAAAUGAUGAAAAGUCAGGUACUGUUUC… 2433 nt 0.5368
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the PCDHGB1 was significantly upregulated in the hippocampus of methamphetamine-addicted animals following a running exercise intervention, which correlated with a reduction in conditioned place preference days [Li et al. DOI:10.21037/atm-22-450]. In human forensic research, members of the protocadherin gamma gene family, including PCDHGB4, PCDHGB6, and PCDHGB7, were identified as differentially expressed in peripheral blood across age groups and were incorporated into a validated mRNA-based age prediction model [Liao et al. DOI:10.1016/j.fsigen.2025.103373].