Basic Information

Symbol
PCDHGB4
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily B, 4 CDH20 FIB2 PCDH-GAMMA-B4 Fibroblast Cadherin FIB2 Protocadherin Gamma-B4 Fibroblast Cadherin-2 Cadherin 20 PCDH-Gamma-B4 Cadherin-20
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_003736.4
Sequence length
4761.0 nt
GC content
0.5493

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1742.10 kcal/mol
Thermodynamic ensemble
Free energy: -1821.68 kcal/mol
Frequency: 0.0000
Diversity: 1204.31
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((.(((.((((((.((((((.(((((.(((((((..((.((((((((((((...(((((((...)))))))((((.(((.((........)))))))))((((((((.....((((.....))))(((((....))))).)).))))))..(((....)))...)))))))).).))).))..))))).))))))).)))))))))))).)))(((((((((((((.((((((((..((((((((((((((((.((((((((..(((((((((((....((((((((.(((..(((..((......))..))).)))))))))))....)))))...(((((((.....))).))))..(((((...))))).....((((((.(((...(((.((((.....)))).)))))))))))))))))))))....((((((.....))))))....))))).))))))).)))))))))....(((....)))..(((.(((..(((....)))..))))))(((((((..(((((((((((((.(((.(...(.((.((....)).)).).).)))..)))))))((((.....)))).(((((......(((((.((.((.((((.((((..(((.(((...((((((((((((.......))...(((((((((......))).....))))))(((.((((..((.((((((((((.............)))))))..))).))....((((((.......))))))((((....)))))))).)))....)))))..))))).....)))..)))..))))..)).)).)).)))).)))......)))))...((((((...(((......))).))).)))...)))))).........))))))).)))).))))....))).))))))))))...((.((((((((.......))).).)))).))..)))))..(((((((((.(((((((........((((......))))...((((((.......(((.(((.......))).)))..((((......))))...))))))..............((((((...))))))........(((((......)))))...(((...((((((.....(((((.(.(((((((..(((.(((....(((((........)))))...))))))...))).))))))))))))))))...))).....(((((((.(((((((.((......((((((...(((((..(((((.......)))))..........(((((((((......(((((.((((.......)))))))))........))))))))).....(((..........)))...(((.((((((........)))))).)))..)))))))))))..))))).))))........((((.......))))..)))))))(((((((..((((...((.(((.((((..((((..(((...((((((((((((((...(((..................))).))))).)))).....)))))..........((((((.((((....).))).)))))).((((....))))..)))..))))..)))))))))..)))).)))))))...((((((((.....(((.(((.....(((((((((((((((((.((.(.((((..(((((....(((....)))(((((((((((((.(((((.......((((((((((.(....((((((((..((((...))))....))))))))(((((((((.((((....))))...))).))))))).))))).)))))....((((.(((((.....))))).))))..)))))...)))).)))).)))))...(((..(((((((((...)))).)))))))).((((((((((.(.(((((((((((((..(((((((....(((((((((((((...(((((((((((((....))))).))))).)))..(((((((((((((...))))........((((.(((.((....(((((.(((((((((((((((((.....)))))(((((....))))).((.(((((....((((.((...)).))))....))))).))....)))))))))))).))))).)).)))..))))....((((((......((((((((.(..(((((((((....((((.(((..(((......((.(((.((.(......(((((((......)))))))......).))))).)).......))))))))))....)))))))))..)))))))))...(((((((......(((((...))))).....))).)))).)))))))))))))))..(((((......((((((...)))))).)))))....((((......))))......(((((...(((.((((((...(.((((......)))))...)))))).)))((((((((.(((((.....((((((....))))))...(((((((((((.((..(((......(((((.(((((((((.((((((((((.(..((((...((.((.(.........).)).))...))))..)))))...........))))))...)))))))))....((((......)))))))))...)))..)))))))))))))(((.((((((.....))))))..)))....))))).)))).)))))))))((((....))))..)))))))))))))........((((((..((((..........((((....))))((((((..(.((((.((((((..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).))((((((.....))..))))..((((((.......)))).)).(((((.((..........))..)))))......)))))).)))).)..))))))......))))..))))))(((((((((((((((((.((...)).).))))))))........))))))))))))))).))))))))))))).))))))))))))))))...)))).).))..)))))).......))))).....)))))).....))).))).....))))))))....))))))).))))).)))).....(((((.((((..........)))).))))).............................((((....)))).
Thermodynamic Ensemble Prediction
.{((((((((..((((((.((((((.(((((.(((((((..((.((((((((((((...{({((((...}})))))((((.(({,((........)))))))))((((((((.....((((.....))))(((({....))))).)).))))))..(((....)))...)))))))).).))).))..))))).))))))).)))))))))))).))))){{({(((,,,,...||,|}}}}((((((((((((((((,(((((((,.{(((((,{(((({,..((((((((.(((..(((..((......))..))).))))))))))}....)))))..,(((((((|....))).)))).,(((({...})))).....((((((.(((...(((.((((.....)))).)))))))))))),))))))))..|||||||.,))).)).)))..},))))}.})))))).))))))))).(((((.((((((..((({,(((..(((....)))..))))))).,{{.......,,,(((((((.(((.,...{.((.({....}).)).}.}.)))..))))))){{{,.....}}}}.{{{,{......}}}))}..)))))).)))))....(((({......})))){((((.{{(((((,...,((((((,,.....{|||.....|||||.(((,({{{,,((,(({{((((((..,,.........)))))))..}}),)).,..,,{{{{}}},,.,))))}|((((....}}}}}},|.|}}....}}}}.....})}}},{||{,||||{,||,...,((((.{((((((...........{(({((,{{{(({{,.....,.}}),))).))).}}}..........))))))).))))))))))}.))))).))))))}.)))}(((((((((((((((((,(,...,..}))))),.,,{||{,|{((...(((((((((.(((((((,,,.,,..((((......))))..,||{||,.{{{.,{(((,({{,.....,||,{{{{...........}}}}{,||,.,,{|||||.....,..,.|{{|||||.,,}})),,,.....(((((......))))),,,,(((((,,(((((((..,{(((.({...)),}}}}((((((....(((((........)))))...(((((.{{.{((.{,{(((((.(((..,{,..{{,......}},})..|..)}))))))}.,,,{||||{|,,{({({..{((((.,.....}}}}}..........(((((((((....,.((((.{((((.,...,.)))))}))}........))))))))).....(((..........)))...(({.((((((........)))))).}))..)}))}}}}}}}..||}}}.))),.......,)))))..)))))).}..)))))))}}}}}.((((((((.........))))))))....{,,...((((((((({{(((.,.({{..........,...,,.,|||,|}|}}.,,,}.,..,||}||,,........((((((.((({....).))).)))))),((((....))))..)))}},...,},.}}.}))),})))}})))))),,|,((((((((.,...(((.(((.....(((((((((((((((((.((.(.((((..(((((....(((....)))(((((((((((((.(((((.......((((((((((.(....((((((((..((((...))))....))))))))(((((((((.((((....))))...))),,)))))}.))))}.)))))....((((.((({(.....))))).))))..)))))...)))),}))).)))))...(((..(((((((((...))))))))))))).((((((((((.(.((((((((((((((((((,(((....(((((((((((((...(((((((((((((....))))))))})).))).,(((((,{(((({{...})}}|||{{,..|||{.,|||,|||},(((((.(((((((((((((((((.....)))))(((((....))))).((.(((((....((((.({...}).))))....))))).))....)))))))))))).)))))..,.}}|..}}}},...((((((.{{...((((((((.(..(((((((((....((((.(((..{((...,(.((.(((,((.,......(((((((......))))))).,....),))))).)),,.....}}})))))))....)))))))))..))))))))),,.{{{{{,,......{{,{{.{{||||}.....,}||}}|,.)}))))||||||,||..,((((......((((((...)))))).})))}|}.}|||}},....})))}....}||}}||{{(,,.,,,|}}}}.,,||{{......,}}),|||||||||.||(((({{{{{....,.....||||{{{|||,)))}}|,,,((((((((((,,((..(((......(((((,(((((((((.((((((((((.(..((((...({.((.(,........),)}.}}...))))..})))).,..,......)}})))...))))))))),...((((......)))))))))...)))..)))))))))))))}{||{,,,||,}}}|}||||||{||,.|..}})).,))})}))))}},.,||{|,,,,)})),.)))))))))))))...}}}..,.||||}..((({{.......}||||....||||(..(((.,....}))},))))}.((.(((((((..((.((({({{((,((,,..((.....((((((((((..(({..((((((.....(({.,..(((((((((((...(.(((((((((.(((..(((((((((((((((.,...(((....((((....)))).....))).....))))).....((((....)))){((((((.((((((..(({(((((((((.....,......((((.......))))......},.....)))))))))..,....(((....})|((({,,.{{||,,,.|||{{{{......|||||{.......,(((((.((((((((.{({.......,.,})))).....)))))))))(((((((....))))))){((((((...............{((((....,...((((((,.,,,.,,.,((((((((((((({(((.((((,(((((,.(((..((({((..((((.(((((.(({.,,(({,,,...{{{((,,,....,,,{{,,,,,..||{,{||{..,,.,....},}))}}}.},}.{{({...,}}}.......,|||,|{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||}},})))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.{((,...}}},..,|....,||..}},})}.}}}...}}},,.})).))))),}))))))))},))}(((......))){{{(((,(((.((((....))))))))))))),,........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))}||}((((((((,,((..({{(,||,)}}}..,)}),,.,..,...{(((((...............)))))|(((((((({{({,........((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).))))}))))))))}.)))))))).)}))))}}.)))))))||}))..))))....}}.)))))))))))))))))(((((((.((.((((((((.((..(((((.(((({,.........(((((((((((((......(((((....)))))...))))))))},)))).(((((....)))))...})))).)),,))...)))).)))))))).))))...)))))))))).))))))...))))))).....,}))....))))))))).)))...)),}))))))).,...,}}},}))))},})))).,)}..))))))).)).((((((((............(((((((.((((.((((...((((({({{,..{,{,...,(((({{........)))))),).}.}).).)).))))).)))))))).))))))|(((((({((((((({,((,..}}.},)))}}))),.......)))))),,))))))))))))))))))))).))))))))))))))))...)))).},))..)))))).......))))).....)))))).....))).)))....,)))))))).,..))))))).))))).))))...))}||||.,,,|..........|,|,,,,,|((((({.......}))))},.......))))),.,))))))..

Transcripts

ID Sequence Length GC content
AGGGCAGCCCCAGCUCAGACUCCCCAGCGCCAGCCUUUACACCGCUUCC… 4761 nt 0.5493
AUGGGGAGCGGCGCCGGGGAGCUGGGCCGGGCUGAGAGGCUGCCAGUGC… 2412 nt 0.5357
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. This particular family member is expressed in fibroblasts and is thought to play a role in wound healing in response to injury. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans delineated age-associated mRNA expression patterns in peripheral blood, identifying 79 differentially expressed genes (DEGs) including the PCDHGB4 as a member of the protocadherin gamma gene family that was differentially expressed between young and elderly individuals [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].