Basic Information

Symbol
PCDHGB5
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily B, 5 PCDH-GAMMA-B5 Protocadherin Gamma-B5 PCDH-Gamma-B5
Location (GRCh38)
Forensic tag(s)
Chronological age estimation Drug abuse diagnoses

MANE select

Transcript ID
NM_018925.3
Sequence length
4755.0 nt
GC content
0.5510

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1747.40 kcal/mol
Thermodynamic ensemble
Free energy: -1828.90 kcal/mol
Frequency: 0.0000
Diversity: 1277.83
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((..((((((.((((((.((((((..(((((..((.((((((((((((.........((.((((......)))).))((((........))))(((((((((.................(((((....)))))))).))))))..(((....)))...)))))))).).))).))..)))))..)))))).)))))))))))).))))))((((((((((((.(((((...((((((((((((((((.((((((((..(((((((((((....((((((((.(((..(((..((......))..))).)))))))))))....)))))...(((((((.....))).))))..(((((...))))).....((((((.(((...(((.((((.....)))).)))))))))))))))))))))....((((((.....))))))....))))).))))))).))))))))).(((((.((((((..((((.(((..(((....)))..)))))))..............(((((((.(((.(...(.((.((....)).)).).).)))..)))))))((((.....)))).(((((......)).)))..)))))).)))))...(((((((((((....((((.(((....((........))......)))))))...)))))))).)))............(((((((.((((...)))).)))))))..((((((((......(((((..((((....((......)))))).)))))..........))))))))(((((((..((.((((.((((..(((((....))))).))))))))))..))))))).((((.(((((((..((((.................((((.....)))).(((.........)))....((((((.....(((((....)))))((((........)))).....(((((((.(((..(((........)))............(((((((((((..((((......(((((.((((...(((((((((.((........)).)))..............)))))).)))).)))))........)))))))))))))))((((((.(((((((((((..((......((..(((((........((((((..((.((((....((((......)))).....)))).))..)))))).((((...(((..((((.((((.((((.........(((.((((.........((((....(((((((((...((((((((((.((((.....(((.((((.(....))))).))))))))))))))))).................(((((...((........))..))))).......))))))))).....))))..)))).)))....((.((((((.....)))))).)).))))))))..))))..))).....))))......)))))..))..)).))))...)))))))..)))))).))).)))))))..)))))).....(((....))).........(((((....))))).))))))))))).))))(((((...(((((.(.............).)))))..))))).)))))..)))))...)))))))....((((..((((.(((((..(((((((((.((((((((...))))...((((((((((((((((((((((.(((((.......((((((((((((....((((((((.(((((...)))))...))))))))..((((((((.(((....)))...)))).))))..))))))).)))))....((((.(((((.....))))).))))..)))))...)))).)))).)))))...(((..(((((((((...)).)))))))))).((((((((((.(.(((((((((((((..(((((((....(((((((((((((...(((((((((((((....))))).))))).)))...((((((..(((((((((((((.(((((.....))))))))).....((((((....)))))).)))))))))..((((((....))))))))))))((((((((...((((((((((((((..(((...)))...((((.(((((.(.(((..........))).)..))))).))))......)))))))).))))))........))))))))...((((((((((((((((((((((((((((((((......)))))..((.(((((((.((.((.((..(((((((......).))))))..)).)))).....((((((((((((((.((((..((((((((......))))))))..(((((((((((.(((..((((......((((((...)))))).))))))).))))))).....))))....(((..(((((......)))))..)))..(((.....)))((((..(((((.(((((............(((((((((.((.((............))))))))))))))))))(((......(((((((.((((((((.......)))))...))).))))....)))......))))))))))))(((.....)))......)))))))))))))))))))).))))).))......((((....))))(((.((((.((...)).)))).)))...)))))))))....)))))..)))))))))).)))......((((....))))..)))))))))))))........((((((..((((..........((((....))))((((((..(.((((.((((((..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).))((((((.....))..))))..((((((.......)))).)).(((((.((..........))..)))))......)))))).)))).)..))))))......))))..))))))(((((((((((((((((.((...)).).))))))))........))))))))))))))).))))))))))))).)))))))))))(((((.(((.((....................)).)))...)))))......)))..)))))).).)))..)))))))))........)))))))))...(((((.((((..........)))).))))).........))))................((((....)))).
Thermodynamic Ensemble Prediction
.((((((..((((((.((((((.((((((..(((((..((.((((((((((((.........,,,||{{......}|||{,|({{{.....,,.))))(((((((({.....,,.......,,{(((({....)))))))).)))))).,(((....}})...)))))))).).))).))..)))))..)))))).)))))))))))).))))))((((((((((((.(((((...((((((((((((((((,(((((((,.{(((((,{(((({,..((((((((.(((..(((..((......))..))).))))))))))}....)))))..,(((((((|....))).)))).,(((({...})))).....((((((.(((...(((.((((.....)))).)))))))))))),))))))))..|||||||.,))).)).)))..},))))}.})))))).))))))))).(((((.((((((..((({,(((..(((....)))..))))))).,{{.......,,,(((((((.(((.,...{.((.({....}).)).}.}.)))..))))))){{{,.....|}}}.{{(,{......}}}))}..)))))).)))))...(((((((((((....{({(.(((.,..((........)).....,)))))))...)))))))).)))............(((((((.((({...}))).)))))))..((((((((,.....(((((..((((....{{......))}))).)))))..........})))))))(((((((..((.((({,((((..(((((....))))).))))))))))..))))))).((((.(((((((..((((,{{,........,,,,.((((.....)))).(((.,.....,,}}}.{,,((((((.....(((((....)))))((((,....,,.)))).,.,.{((((((.{{{..|((|||.,,..,,,........,,..(((((((((((..((((......(((((.((((...(((((((((.((........)).))).........,...,)))))).)))).)))))....,,..)))))))))))))))||||((((((.(((((((..((....,,{...|{{{{..,,....((((((..((.((((....((((......)))).....)))).))..)))))).{({{...(((..((((.((({{((((.........(((.((((.........((((....(((((((((...((((((((({,((((.....(((.((((.{....))))).)))))))))))))))))........,,,.....,{{(((..{.,..}..,}}}}..,}))}.......))))))))).....))))..)))).)))....((.((((((.....)))))).)).))))))))..))))..))).....}}}},,,...})}}}..,,,,)).))))))}.)))))}}}}))))}.}}}.)))))))..}}}}},.....(((....))),........(((((....))))).))))))))))).))))(((((...(((((,(.............,.)))))..))))).)))))..))))),..}))))))..{((((...,{{|||||,,..(((((((((.(({,((((...))))...((((((((((((((((((((((.(((((.......((((((((((((....((((((((.(((((...)))))...))))))))|.((((((((.(((....))}...)))),,)))..))))))).)))))....((((.(((((.....))))).))))..)))))...))))},))).))))).{.(((..(((((((((...)),})))))))))|((((((((((.(.(((((((((((((,,(((((((....(((((((((({{{...{{{((((((((((....))))))))})){|||,,.{{{{{{}|||||{||||||||}{{{(({{,,,|||||||||{{{..((((((....)))))).||||||||}{.((((((....))))))}}}}}}((({{{(({,{{{(((({{.(((,...(({{.{{{{(({({((.(((((.{.{((.......,,.))),,..)))}}.||||.....||}}},}}||}})))}...}}}.,)))|||||{{{(((((({{,((((((({(((..,,,,(((((,,{{,,{{||||((((({{((({{{{{|||.((..(((((((......),})))))..)).|{{{.,.,{({({,,,.||||||.,|}|}.((((((((......))))))))...((((.(((((((....,,,,......(((((({{{||}}},.|||{{{,.,,,,},,...,))))}....|||..(((((......)))))..|}|,.{{{....,)))(((({...,.((((((((..........,(((((((({{((.((...,........)))))))))))))},.{{(.,.....})).,{(({(,..,.((((,.((((,.|..((((((((.,.,,(({(({...{((({.,|{{,,|((({,(((|.,,,,,..,,,)})}).},))).).))}))...((((......))))}}}})))}{{|.{{{|,||...)),)))).)}|,,|}))))}}))))))))..)..)))).})))).)}},}}},.)).)))))),)))))}))))))))))){{{|.{{...(((({..(((..........((({....}))),..{{|......}))}})))).}||}||,,|||}}||}|||.|}}||}||}}}.||}}}}.,{,{{,,,{|{{(({.,(((((({{{..({,...{((,(({{(((({..,.((({{,{||}|||,,{{|||||,{{,||{{..}}}|||,,,.|{||,.,,}})),,..,)))..,},})))),....{{||,.,,)))),,|||||}||||||,,{{{(((((((((....,,......((((.......))))......|,.....}}}))))))..|....{{|,...|||((({{{{(((|.|{,(((((,....,|.||||||.....}}}|||||.{{((((({..{({,,,......,}}}}.,,,,)}}})))))(((((((....))))))).,,(((({{,{{{{........,,,,({{{{{{{{((((((,{((({{{{{,(((((((({,,,,,{(,{,,(((((,,..(((..(((,((,.((((.(((((,((,.,,(({,,,...{{{((,,,...,,,,{{,,,,,..||{,{({(..,,.,....,,}}}}}}.}}}.,{({...,}}}.......,|{|,{{..((((((((({,{{,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||,,,,)))))}.)))},)))))))))...))))))))}....,)},))))))))..,||{||..}}..))))||.{{(....}})...,,....,||..}},})}.}}}...)},,,.})).))))),})))))))),})).|||....,}))),,,,,{{(((.((({....))))))}))))))))...,...,)))))))),})))}}))).))))},))))))))})))),...(((((((....))))))).....|||||||||((|{(,,,(((..(({{(..,}}}}),,)}}.},)))})},,...{(((((...............)))))|(((((((({{(,,.......,((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....})),{((.((.(((((((.((((((...))))))))))))).)).))))}))))))))}.|}||}|||{||||||{{.|||||||{{|||{{||},....,..},,))))))))))||||((((((({((.((((,((({(,...,,,,.,,,,.}}}}}.}}}}(((((((((((((......(((((....)))))...))))))))},)))).,{{{{.,,{||||}...,|||,.,,..,,}},||||,|||}},}|,|}}}...,)})))}}}),))))))...)))))))...,}))))}...))))))),,.},,...|}..,}}}})}})}}}}),,}))))),.,}))),})}.,)))}))),))}||||||||.......||,..(((((((.((((.((((...((((({(({,..{,{,...,(((({(........)))))),).}.}).).)).))))).)))))))).)))))))|||||||||||||{,|||,,})}}}}))}))))))}},,}.,)}))))}.))))))),))))))))))))).)))))))))))(((((.(((.((................,...)).)))...)))))......)))..)))))).}.}))..)))))))))........|||||}}})}))|{(({.((({..........},}}.}}}|{{{{{,.......}}}}}},...,,..,}.{(((....)))}.

Transcripts

ID Sequence Length GC content
GCAGCCCCAGCUCAGACUCCCCAGCGCCGGCCUUUACACCGCUUCCUCC… 4755 nt 0.5510
AUGGGGAGCGGCGCCGGGGAGCUGGGCCGGGCUGAGAGGCUGCCAGUGC… 2457 nt 0.5336
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that selection for ethanol preference significantly affected a large number of cell adhesion molecules, including protocadherins, with the PCDHGB5 being part of a family antisense to a non-coding RNA hub broadly affected by selection in the nucleus accumbens shell [Colville et al. DOI:10.1111/Gbb.12367]. In human peripheral blood, members of the protocadherin gamma gene family, including the PCDHGB5, were identified as differentially expressed between young and elderly individuals and were incorporated into a robust age prediction model with a mean absolute error of 6.72 years [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].