Basic Information

Symbol
PCDHGB7
RNA class
mRNA
Alias
Protocadherin Gamma Subfamily B, 7 PCDH-GAMMA-B7 ME6 Protocadherin Gamma-B7 Cadherin ME6 PCDH-Gamma-B7
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_018927.4
Sequence length
4775.0 nt
GC content
0.5533

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1725.70 kcal/mol
Thermodynamic ensemble
Free energy: -1807.45 kcal/mol
Frequency: 0.0000
Diversity: 1535.27
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((..(((((........((.....((((.((((.(((((..((.(((((................(((((((((....((((((((.......))))))))......((((...(((((.(((((((((((((((((((...((......((((.............))))......))...)))))))).)))))((((((((((((...))))..((((((((........))..)))))).))))))))))))))...)))))...))))...((((...........)))))))))))))))))).))..))))).)))).)))).....))(((((((((.....)))))))))((.((.(((((((.((((((...(((.((((.....)))).)))...))))).).))).)))).)).))....((((((((((..(((.((.(((((...((((((....((((.((((....((((((..(((...(((((..(.(((((............................((((((.(((((.....))))).))))))((((.......((((....(((..............))).....)))).......)))).(((((.(.((...(((.(.(((.(((((....((..((((((((.......((((.(((((((..............).))))))))))..(((((((.....((((.(((((..(((.......)))..))))).)))).......((((((.((((((((((((((.((((.((((((.(((.......)))..)).))))(((((...)))))..)))).).))))........((((.((((.......................)))).)))).(((((..(((((...(((((.((..((((((.((.(((((....))))).))..))))))((((...((((..((.....((.(((((((.((((..(((((((.(((..(((((((.((((((((((.....))))..))))(((((.((.(((..........))))))))))(((...((((...((...))...))))))).(((........)))......)).))))).....))..))))))))))......(((((........)))))....(((((.(.((....)).).)))))...................((((((............((((((.....)))))))))))))))).))))))).))....))..)).))...)))).((((((((((....((((((..((((((...((.(((((..((.......((((((..((((.(((.....((((((.....)))))).))).))))...))))))(((......)))((.((..((((((..((.(((((((.((((((((((.((((((.(((.......((((.(((((....((((.((......((((((((..(((.(((......))).)))))).))))).....(((((......)))))..........)).))))((((....)).))..(((((.....))))).......((((((((((((((((((.((((...((.((.......)).))...)))).))))...)))))........(((((...(((((((....((((.((((.(((((((((((..((..(((....))))).)))))))......)))))))).))))..(((((((....((((((((..((((...))))....))))))))..((((((((.(((....)))...)))).))))..)))))))(((((((((......))))....)))))..)))))))...))))).(((((.(((((((((...(((((((((((((...)))....))))))).))).))))).)))).))))).....((((((((.((((...)))).))).))))))))))))))((..((((((((((((((((((((..((.((((((((.(((((.(((((..(((((....(..(((.((((..(((((.((...)).)))))...).))).)))..)...))))).....)).)))))))).)).)))))).))))))))))..........(((((...((..((((..........))))..)).)))))...))))))))))))..)).)))))..))))))).)).)))).)))))...))))))))........((((((((.....(((....)))...)))).))))(((((((((((.....)))..))))))))(((.(((.(((....)))))).)))...(((((....)))))...........))))))..))))))..)).))..........(((((((.(((((((((((..((....((((.......))))....))..))))))....))))).)))))))))..))))).))......))).)))..))))))..))))))...)))).((......))...(((((....)))))....)).)))))......)))))..))))))))))))...)).)))))).((((....((((((((..((...(((((..(((..((((((((((.(.(((.....))).).).))).).)))))...((((......)))))))))))).)).)))))))).))))..)))))))..((((((((((((((((.(((......)).).)))(((...((((..((((.((...(((((((((.((((.....((((((..((((..........((((....))))((((((..(.((((.((((((..((.(((((((..((.(((((..(((((....((.....((((((((((..(((..((((((.....(((....(((((((((((...(.(((((((((.(((..(((((((((((((((.....(((....((((....)))).....))).....))))).....((((....))))(((((((.((((((..((((((((((((............((((.......)))).............))))))))).......(((....)))(((((....))))).(((((((......((((((........(((((.((((((((.((..........)))))).....)))))))))(((((((....)))))))(((((((...............(((((........(((((((.........(((((((((((((((((.((((.(((((..(((..((((((..((((.(((((.(((...((((((.(.(((((..........(((((((..(((.((((..((........)))))).))).((((...)))).....(((((..((..(((((((((.(((..(((((.(((...(((((....((((((((.(((.((.....(((.(((..((.....))))))))))))).)))).)))))))))...))))))))....))).)))))))))..........))..)))))..(((....))).....)))))))..)))))).)))...)))...))).))))).)))))))))).)))(((......)))((((((.(((.((((....)))))))))))))..........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))))))((((((((((((..((((....))))..))))...........(((((...............)))))(((((((((.((..........((((((((((((((.....)).))))))))))))....(((((..(((.(((((((.((.(((.(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).)))))))))))))).)))))))).))))))...)))))))..)))..))))....)).)))))))))))))))))(((((((.((.((((((((.((..(((((.(((((..........(((((((((((((......(((((....)))))...))))))))).)))).(((((....)))))...))))).)).)))...)))).)))))))).))))...)))))))))).))))))...))))))).....))))....))))))))).)))...)).)))))))).....))....))))).)))))..))..))))))).))((((((.....))..))))..((((((.......)))).)).(((((.((..........))..)))))......)))))).)))).)..))))))......))))..))))))(((((((((((((((((.((...)).).))))))))........)))))))).).))).)))))))))...)).)))).))))..)))....))).)))))))))).))))))))..))...............)))))))).).))).)).).)))))..)))))).))))))))..))))))....))))...)))).)))))).))))))).))))))))).))))...............)))))))))....
Thermodynamic Ensemble Prediction
..((((,.(((({,,,,{{{{((.....((((.((((.(((((..((.(((((,.,.,,..........(((((((((..,.((((((((.......)))))))),|,...((((...(((((.(((((((((((((((((((...{(......((((..{.....,.}..))))......)}...)))))))).)))))((((((((((((...))))..((((((((........)),.}))))).))))))))))))))...)))))...)))),,.{({{......,....)))})))))))))))))).))..))))).)))).)))).....}}(((((((((.....))))))))){({(,.(((((({..,|)}|}}},,||||{{.,..||}|,.}}}}.{|{|{{{|{||}{|||,{||{||..,,{((((((((,..,,,,(,{(((((.(((....|))..,((((({{{{...(((((({{(,(,.,(,,,,((((((((,..,,,,,{{{{{.....((((({.(,.((.(((.((((((((.{((........))}..))))))))))).)),,)))))).....}}}}}..{(((((...{{.{((..((,((({((((,....,,{,{{,{{{{,{.{{{(({{{{({{,(,,{{,,,..,,.,{(((({(,,((({..,,..,,......|{||,||||||...{{,{|||,....((((.(((((..(((.......)))..))))).})))|......{|||||,{{(((,,,((({{{,|||{|{{{{{|,|||.....}||||..}}.})))(((({...))))),.,}})}),,)))}},}......,|{{((((,.....|||,..,{,...,......)))})},|||||},|||||.}}|||||.,|||||||||,||.(((((....))))).))}})))),)).,}}}.)),)})))}{{{((,.((((((({,.{{.((((((............))))))|{(({(((({....,.)}}))}}||||}}}}||||}}},.}})}}))),...))}|,}}}}|||,}}.{({{{{|.{{{{{.....{{(........}}}......,,.,,,,,}}}}},.}})))).)))))}}}..}|||||.},,{{{.,|||{{{.{({{(({{{((....,{{{,|({((.({{{,{((((({({{.{.,,.....))))..)))))|(((((.....)))))|{{{{.(({,,..))))))},,,.,{{{{(((.({.,{{.(((((({....{(((({{(,,,(((({{{(({{{((.((({,.,|}.}}}}}}|,..}},}}}})}}},.....{(((((.....)))))},|||,||((,,{{((((|,(({{({{,,{{{{((((,{,,,(,{{{({{{(({(((,{,{{{,(((||,,{{{,|{{||.....{,{{{.....{{{...{(((({{....((((((((..{((.{((......))}.))}))).))))),,...{{||{,{{{{{{||||........{{({(({(((({{....,|{||..(((((.....)))))...{{,{{(((({((,,{((({(((.{{{{...{{.{,,,,.,,,,}.)),,,)))),)}}}..,)}))).||,,...(((((,,.(((((((,,(.((((,((((,{{{{(((((((,,{{..{({....))})).)))))))......}}))}))}|||||,((((((((....((((((((..((((...))))....)))))))){,((((((((,,(({,,.|||,..}|}}.,}}|..||||||},|||}||||.}},.,)})),.,,})))}},)))))))..,))))).|||||,||||||{{|,..{{{((((((({{{...}},....))))))).))),))))).)}}),)))))...}}}}|}||}|,||,,},}))))}))))),,,))),}||||{(({,.,,||||||||||||{||{{..|{,{{{|((((.|||||,|||||,,|||{{.,..{..(((,({{{..(((((,{|...||,}||||...|.|}},|}}..}.,.))})}....,))},)))))}}.)).)))))),}}|}}}|||}....,,,,,.{{{{{...||..({{{.{|...},..}))),.}}.)))))}..})})})))))}},}}),)}}}},})))))))})))})))})}}))...}}))))})},.,,,..((((((((.....(((....)))...)))).))))((((((({({(,....}}),.)))))))){{|.||{.|{{...,))))))},,)}}}||{||,,,{||},},||},.|....|||.|||..{{{{{{{{,.{({{{,,...{((((((((.(((((((((((..({....{(((.......}}},....))..))))))....))))).))))))))).....,,.....,|,{{{,{{((({...,,)))))),}},,{|{{|{{{||,||{{{,..(((((....)))))....,,..||,|{|{.{.||||,.{|||||,,|||||.,.||{|,||||,,,,,....((((((((.,,,...(((((..(((..((((({(((,..,(({.....)}},).,.))).).)))))...((((......)))))))))))).,).)))))))).}|||.,}},,,}}..((((((((((((,((({{,.{{{{..||,|{|||{||,.,({{{..{{({,{,..,|(((((,{||{{{{(.{,.,,(((({..(({.....,,...((((....)))),..{{{......|}}||))))..||,(((((((..((.((({{,,((,((,,.,((.....((((((((((..(({..((((((.....(({.,..(((((((((((...(.(((((((((.(((..(((((((((((((((.{...(((....((((....)))).....))).....))))).....((((....)))){((((((.((((((..(({(((((((((.....,......((((.......))))......,,.....)))))))))..,....(((....))|((({,,.{{||,,,.|||{{{{......|||||{.......,(((((.((((((((.{({.........,})))).....)))))))))(((((((....))))))){((((((...............{((((....,...((((((,.,,,.,,.,((((((((((((({(((.((((,(((((,.(((..((({((..((((.(((((.(({,,,(({,,,...{{{((,,,....,,,{{,,,,,..||{,{{|{..,,.,....},}))}}}.}}}.{{({...,}}}.......,|||||{..((((((((({,{(,{({{((.(((...(((((,,,.{{{(((((.({({(,.....{{|,|{|..||,,,,{|||}},})))))}.)))},)))})))))...))))))))}....,)},))))))))..,||{||..}}..))||||.,((,,..}}},..,|....,||..}},})}.}}}...}}},,.})).})))),}))))))))}.))}(((......))){{{(((,(((.((((....))))))))))))),,........))))))))).))).)))).))))..)))))))))))))....(((((((....))))))).....))))))))}||}((((((((,,((..({{(,||,)}}}..,)}),,.,..,...{(((((...............)))))|(((((((({{({,........((((((((((((((.....))}}}))))))))))....(((((..(((.(((((((.((.{((,(((........))).))))).)))))))..))))))))(((....))).(((.((.(((((((.((((((...))))))))))))).)).))))})))))))),.)))))))).)}))))}}.)))))))||}))..))))....}}.)))))))))))))))))(((((((.((.((((((((.((..(((((.(((({,.........(((((((((((((......(((((....)))))...))))))))},)))).(((((....)))))...})))).)),,))...)))).)))))))).))))...)))))))))).))))))...))))))).....,}))....))))))))).)))...)),}))))))).,...,}}},}))))},})))).,)}..))))))).))||||||},,,,.,..}))),..,{|||}..{{{{,,,,}))}|||||}}}}}}},}},,.))}}}},).}}}}..)))))).)))).).)))),)))))}}.))))..}))}))|||||||{,||||||||.{||}}}),}.}})))))))}},}}}}))|||,}}))))))))))))),)},}})).))))}))),.,|{|,...,))).,,,,,,,,,.))).))}}}.,)}.}}}}}}..}}}}.}))))))).)})}}.)}.}.}},,,)))),,,)})),,,))))})),)))}.,{||,|.,.}},,.,,,,,}.}}})))),}}}})))},.,,},...............}))})))))....

Transcripts

ID Sequence Length GC content
AACAGAAAAGAAAACCAGCUCCCACACAGAGGCUCCCGGCUGCGCAGAC… 4775 nt 0.5533
AACAGAAAAGAAAACCAGCUCCCACACAGAGGCUCCCGGCUGCGCAGAC… 2760 nt 0.5232
Summary

This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans delineated age-associated mRNA expression patterns in peripheral blood and established a robust age prediction model using 34 mRNA markers, including the PCDHGB7 which was identified as a differentially expressed gene (DEG) and a member of the protocadherin gamma (PCDHG) gene family that is differentially expressed between young and elderly individuals [Liao et al. DOI:10.1016/J.Fsigen.2025.103373].