| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUUAUCCUGCUGCUGCCGCCACCGCUGCUGCUGCUCUGCAAAAUUCAG… | 1516 nt | 0.6187 |
Fibrillar collagen types I-III are synthesized as precursor molecules known as procollagens. These precursors contain amino- and carboxyl-terminal peptide extensions known as N- and C-propeptides, respectively, which are cleaved, upon secretion of procollagen from the cell, to yield the mature triple helical, highly structured fibrils. This gene encodes a glycoprotein which binds and drives the enzymatic cleavage of type I procollagen and heightens C-proteinase activity. [provided by RefSeq, Jul 2008]
The literature review notes that the PCOLCE is a protein marker showing loss post-mortem in bone, contributing to post-mortem interval estimation in late PMI studies [Alex et al. DOI:10.1016/j.scijus.2025.101320].