| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGACCCCUGAGCAGUGUUCUCUGUGCUGAGCGGCGGGACUGAGCUGU… | 534 nt | 0.4419 |
Enables calcium ion binding activity and calmodulin binding activity. Involved in positive regulation of CAMKK-AMPK signaling cascade and positive regulation of neuron differentiation. Located in cytosol and nucleus. Part of protein-containing complex. Biomarker of Huntington's disease and leiomyoma. [provided by Alliance of Genome Resources, Jul 2025]
A study in Sprague-Dawley rats demonstrated that the PCP4 gene exhibited a biphasic upregulation in the spinal cord at 3 and 7 days post-tibial fracture, followed by downregulation at 14 days, a temporal pattern validated by qRT-PCR [Deng et al. DOI:10.1038/s41598-025-17561-6]. A study in rats demonstrated that Purkinje cell protein 4 mRNA was differentially expressed in the hypothalamus, with 92 tags in control samples versus 34 tags in hypothermic samples, and this higher expression in control hypothalami was validated by quantitative PCR [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].