| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGCCUCGCCAGCUCGCCCCGGCACUGCGCACUUGCCAGCCAGUCCGC… | 1025 nt | 0.7424 |
The protein encoded by this gene functions as an inhibitor of prohormone convertase 1, which regulates the proteolytic cleavage of neuroendocrine peptide precursors. The proprotein is further processed into multiple short peptides. A polymorphism within this gene may be associated with obesity. [provided by RefSeq, Aug 2013]
A study in human trauma patients demonstrated that the PCSK1N mRNA was significantly downregulated in circulating T cells during the injury stage compared to the recovery stage [Rau et al. DOI:10.2147/JIR.S375881]. A study in rats demonstrated that the PCSK1N transcript was differentially expressed in the hypothalamus during hypothermia, with 23 tags in control samples versus 7 tags in hypothermic samples, identifying it as an RNA marker for hypothermic diagnosis [Takamiya et al. DOI:10.1016/J.Jflm.2012.04.017].