Basic Information

Symbol
PCSK7
RNA class
mRNA
Alias
Proprotein Convertase Subtilisin/Kexin Type 7 SPC7 PC7 PC8 LPC Subtilisin/Kexin-Like Protease PC7 Lymphoma Proprotein Convertase Prohormone Convertase 7 Proprotein Convertase 7 Proprotein Convertase 8 Prohormone Convertase PC7 Proprotein Convertase PC7 EC 3.4.21.75 EC 3.4.21.93 EC 3.4.21.61 EC 3.4.21.- EC 3.4.21 HPC8
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_004716.4
Sequence length
4197.0 nt
GC content
0.5747

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1716.20 kcal/mol
Thermodynamic ensemble
Free energy: -1785.59 kcal/mol
Frequency: 0.0000
Diversity: 966.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((..((((((....)))))).))))).(((.(((((((...((.((((((((((((((.((((..(..((((((((.(....(((.((((((...............(((((((..((((.(((((.....))))).)...)))..)))))))......((((((....(((((.((((..(((((.((((..(((((...)))))...))))))))).((((.(((((((((.((((...........(((((((((......((((....)))).....))))))))))))).))))))))).....))))..))))))))).((((((((((((((.(((((((((..(((.((((((((.....((((.......))))((((((((((((((.((.(((((((((((.((((((((((((....((((((((....((((.((((...)))).)).))....))))))))...(((....)))))))))))))((((((((((((.((((((..(.(((((.(((((.((.(((.((.......(((((((..((((.(((..(((((...)))))..)).).)))).)))))))(((((((((.((((......((((...(((((.((.....((((((.(((((((((((.((((((((...(((.((((.((((((((((....)))...(((...(((((.(((((.(.(((.((((.((((((((.....(((.....))))))))(((.(((.((((((..............)))).)).))).)))..))))).)).))).).))))).))))))))(((....)))..........((((((((((((.((((((((.(((..(.(((((((((((((((...((((...))))....)))))))))))...(((.((((((((..((((((((((...))))))..))))........((((((((((((....((((((.....(((...(((......)))(((((((((((.(..((((...))))......((((...(((.((((((((.((((((((((((....)))))).........)))))).......((((.((((..(...(((..(((((.(((((...(((..((....))..)))...))))).))....)))..))))..))))...))))...))))))))...))).)))).).)))))))))))(((((((.(....)))))))).)))....))))))))))))))))))...(((.((.((((((((.....((.((((((....)))))).))))))))))..)))))...((((..(((....((((((((((((.((......)).)))))).)))))))))))))(((((.(((......))).....))))).)))))))))))(((......)))))))).))).))))))).((((.(((((((((.((.(((.(((((((((((((((.(.(((((((........))).(((....)))....))))).))))))...)))..))))))..))).)).)))).))))).)))).........((((....)))).....((((((.(((..(((.((((((((((.............((.((((((((((((((....((((((((((.(((((((.(((((..((((.....))))..)))))(((((.......)))))..((.(((((.(((((.........)))))...)))))))((..(((((...)))))..)).(((.((((.....)))).)))(((((((...(((.((((((.((((((.(.(.(((........((.((((.....)))))).......))).)).)))))).)))).).).))).)))))))))))))))))....)))))))....))))))(((((((....(((((((..((.........))..)))))))....)))))))..))))))))))....)))))..))))).)))..))).)))))).).)))))))).))))...))))))))))).))).....))))))))((((((((((((((.........((.((..((((((...))))))..)).)).........)).))))))))..))))))))......)))))....))..))))))...)))))))...))))....((((((.(....).))))))..........)))).))))))))))).))))))))))))))))..))))))(((((((((.((..(((((((.(((....(((((.((.((((((....)))))).((((.......))))....(((..((((((...........))))))..)))(((((.((((.....)))).))))))).))))))))))))))).........(((((...((.(.((((..(((((((((...(.((((....(((((((((((((...(((((((...((((...))))))))...)))...))))))))))))).......(((((((((((.....(((((.......))))).....((((.((.((((...)))).)).))))....((((((((....))))))))..........(((((((((......((((((....))))))((((.((...)).)))))))))).)))..))))))))))))))).).)))))))))..)))).)))))))).)).))))))))))))))))).))))....))))))))))))).)).)))))).(((((((((....)))))))))...((((((((((.(((((.(..((((..((....(((((((.(..(((.(((.(((........(((((((..((((((((..(((((((......))))...(((((((((.(((((((....)))))....)).)))).)))))....))).))))))))..))))...))).......)))))))))..).)))))))....)).))))..).))))).)))))..((((......)))))))))....((.((((......)))))).))))))))....(((((..(((..((((((((((((.(((((((((.((.((((.(((.((((((((.((...(((..((.((((......))))...))..)))..)).)).))))))))).)))))).......((((((((.....)))))))))))))))))))).)))(((((((........((((((((((((..............).)))))..)))))).................(((........)))....)))))))...................)))))).)))..))))).........))))))))........(((.....))).....(((((.(((.(((((((((..((((...((((((((((...(((((((((((((((....(((((((....(((((((.((((.....((((((((((((........((((...(((((((((((.((((.....(((..(((((....)))))((((....((.............))....)))).(((((....(((.(((((..(((..((...((....)).....)).....)))...)))))))).)))))((.((((((((..((......))..)))))))).))))).....))))....)))))))))))))))))))))))))))(((((((((((((((.....(((....)))...))))))))).((((.(((((.......)))))))))...)))))).((((((((..((...))...)))))))))))).))).)))))))))))....))))))))))))))).)))))).))))((((......))))...))))..))..))))))).)))))))))))..)))))))))(((((.........)))))..)))))...))))))))).)))))))))))).)))...).))))))))..)..)))).))))))..))))))))))..(((((..(((((((((..((((...)))).)))))))))))))).........))))))).))).
Thermodynamic Ensemble Prediction
..(((((..((((((....)))))).))))).(((.(((((({...((.(((((((({(((((.((((..(.,((((((((.(....(((.((((((...............(((((((.{((((.(((((.....))))).)...))}.}))))))).,....((((((....(((((.((((..(((((.((((..(((((...)))))...))))))))).((((.(((((((((,(((((,{,{,...||||{((({{{......{|||..,}}}||,,...}))))))}))))).))))))))).....))))..))))))))).((((((((((((((.(((((((((..(((.(((,,((,{{{((((((({{((({...(((((((((((((((.((.(((((((((((.((((((((((((....((((((((....{(({.{{{|..,|}}}.}}.)).,,.|||||||}...|||,,,,}))))))))))))((((((((((((,((((((..(.(((((.(((((.(,{(((.(({......(((((((.,((((.{{{..(((((...)))))..)},,})))}.))))))){((((((((.(({{...,..{{,,..,((((..,{{|.|,|{,,...{{(({((,(((.((((((((...(((.((((.((((((((((....)))...{((...(((((.(((((.(.(((.(({(.((((({((..,,.(((.....)}))))))(((.(((.((((((..............)))).)).))).)))..}))}}.}).))).).))))).)))))}}}{{{...,})}......,...((((((((((((,{(((((((.{{{....||{{(((((({{{{{...||||,..}})).,,,)))}}},})))..,{{(.(((((((({,((((((((((...))))))..}))),.....|.((((((((((((,...{(((({.....{|{...(((......)))(((((((((((.(..((((...|}}}.{{..(((((,..{,,.{((((((({((((({((((((....)))))),,,......})))))|,.,,,{{||||{|||}{{{,,{{{,,||,,|.{{{||||.|||||{{|,..}}..}))},.,,,,,.},....})}..}},,|.||||...))))..,)))))},}.,}))).,))}.).)))))))))))(((((((.{....}))))))).,}}....}}}))))))))))))))).,,(((.((.((((((((.{..,({.,(((((....)))))),).}))))))),,)))}}...(({,.|(((.,..((((((((((((.((......)).)))))).))))))}}|||||(((((,(((......))).....))})}.}}))))))))}{((......))))))),,|||,|}}}}}}.{(((.(((((((((.((.(((.(((((({((((((((.{.((((.,..}}.....|||.(((....)))...}))}}}.)))))),..}))..))))))..))).)).)))).))))).)))}.......,,||||..,,||||{{,,{({{(((,(((,,({(.((((((((((.............((.((((((((({{(((,{{.((((((({((.(((((((.{{(((..((((.....))))..)))}}(((((,....,.))))){,({.(((((.{({{{....,,,,.}}}}},..|||||||{{{(((((((.....,.)))))))|,|||{...,,))}}.},.(((((((...(((.((((((.((((((.({(.,(({......,((.{{{,..,..))}},,...}}}.,,)},).)))))).)))).).).))).)))))))))))))))}).,,.))))))).,.,))))})(((((((....(((((((..((.........))..)))))))....)))))))..)))))))))).,},}}}},..))))),))}..})),))))))}).)))))))).))))...))))))))))).)))....,))))))))((((((((((((((,,.......((.((..((((((...))))))..)).))......}}.)).))))))))..)))))))}....,,|}}||{{{{||..|||,||.,.}}}}))),.,)))}.,,,{{{{{{.|....}.))))}}........},}})).))))))))))),))))),))))))))))..)))))){((((((((.((..(((((((.(((....(((((.{,.((((((....)))))).((((.......))))..(((((.,..((((....)))....,)))))..{{((((((.((((.....)))).))))))))))))))))))))))).......,.(((((...,,.(.((((..(((((((((...(.((((,...(((((((((((((...{(((((,,,,((((...)))),}),}}.)),},,))))))))))))).......,((((((((((..,(,(((((.......))))).,.,,{(((.((.((((...)))).)).)))}....((((((((....))))))))..,.......{((((((((......((((((....))))))((((.((...)).)))))))))},)))..))))))))))))))).).)))))))))..)))).}},))))),))}))))))))))))))))).))))....))))))))))))).)).)))))).(((((((((....))))))))),{{(({((({{,,.,||{|.|}}||{(,,((....(((((((.(..(((.((,{(((........(((((({,,((((((((..(((,,,,{{{{{{|,,|{{{((,{,,,{|}|,(((((....)))))....))},,))})))))....))).)))))))).,))))...))).......)))))))))..).)))))))....,|,||}}..,.,),,)}))}}}..((((..,,..)}))}||||..,....|{{|,,,.,,)))},,.)))))))))...(((((..(((..((((((((((((.(((((((((.((.((((.(({,((((((((.((...(((..((.((((......))))...))..)))..)).))}})))))))).)))))).......((((((((,....)))))))))))))))))))).)))(((((((........(((((({((((,.,,...........)}))))}..)))))).........,......,{((........}}}....)))))))...{.......},,.....)))))).)))..))))).........,,,,,,,,........(((.....))).}}}}|||||||||}||||,||||}.(((((({(((,,,|||,.}}|||||,,,((((((({...(((((((,{.,((((((,.(((((({.((({{(((((((((((({.(,{(((..,(((((.{{...}|.)).))).,.,))})}.))))))))).})))))))})))),.......(((((({{.{(({((((((((((((,,,,{,{{((,..,{....,....})}..,,||{....,,....||}||{.,,,.}||{{{((((((((......,,)))))}},,|{{{{{.{.......,,}}}}},...,,)))).,..}.)))))))))))),})))|,(((((((((.....(((....)))...))))))))).||||.((((({{{...{{{.((((.(((((({((|{(((((((((((.......}}))).))))).))}.}.)))..)))))).)))),))),}},,))))))})|||},..)))}}}}))))....,,..))).)))),)}))))))..)))))))))))..))))))))}(((((.........)))))..)))))...))))))))).)))))))))))).)))...).)))))))).,}..)))).)))))}..))))))))))..(((((..(((((((((.,({({...)})).)))))))))))))).......,.})))))).))).

Transcripts

ID Sequence Length GC content
AAGCCGCGAGUUUCCGCAGGGAGGCGGCGGCAGCUGCGGCGGGGCCGGU… 4197 nt 0.5747
Summary

This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]

Forensic Context

A study in human patients identified PCSK7 as a mechanistically relevant mRNA that was upregulated in myocardial fibrosis compared to acute myocardial infarction [Wang et al. DOI:10.3389/fcvm.2021.664044].