Basic Information

Symbol
PDCD1
RNA class
mRNA
Alias
Programmed Cell Death 1 PD1 CD279 HSLE1 PD-1 Systemic Lupus Erythematosus Susceptibility 2 Programmed Cell Death Protein 1 Protein PD-1 SLEB2 HPD-1 Programmed Cell Death 1 Protein CD279 Antigen ADMIO4 AIMTBS HPD-L
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_005018.3
Sequence length
2097.0 nt
GC content
0.6505

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-993.10 kcal/mol
Thermodynamic ensemble
Free energy: -1024.95 kcal/mol
Frequency: 0.0000
Diversity: 469.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.........((((.((((((..((((.((......((((((((((.........)))).)))))).((((((..(.((((....)))).)))))))....(((((((((.(((((...))))).))))....))))).((((((((((..........(((((.((((((((((((((....((((((((((((......)).))))).(((((((((.((((........))))))))..(((((...(((((...((.((.....)))).)))))..((....((((((.((..(((....)))..)).))))))))((((..((((((.((((..(((((((......((((...)))))))))....))..))))))))))..)))).))))).....(((.(((((((..((((.(((((((((((((((((((((((((.(((((.((.....))..)))))(((((.((((.(((((.(((......(((((....))))).(((((((.(((((((((((((..(.((((((((.((((.........)))))))))))).).))))).))...)))))).....))).))))...((..(((((.((((.(((.((.((.(((((((((((..(((((.....(((((..((((((..(((.((((((((.(((.((((......((((((((((.((((.((((((....(((((.(((((....)))))(((.......).))..((((((((..((((((....((((((((.((((((.(........).)))))))))..)).)))..)))))).........(((((.(((((((((((((((((((((((((...((((((...))).))))))))).......((((...(((((((((((.((.((((((((((.....(((((...((.(((((..............))))).)))))))...))))).))))).))))))).)..)))))..))))))))))....))))))))).)))).)))))...)))))))).(((((.........)))))....))))).....((((....))))......)))))).)))).)))))).).)))......))))))).)))))((((((.((.((((...)))).)).))))))...........))))))))))))..))))).....)))))((.((.((.((....)).)).)).))....))))))))))))).)).))))))).))))).))))).)))))..))))...)))))....))))))))))))..))))))))))))).)).))...))))))).))))))).)...((((((...((((((....))))))(((...(((....)))...)))..(((....((((((((((.....(((((((((.(((((((((((.((((........))))))))))..).))))..)))))))))(((.((((.((.((((((((......)))...........)))))..))..)))).)))(((((....))))).((((.((...(((.....(((((.((((((((((((.(((((...)))))...)))))..))).))))))))).))))).)))).))))))))))....)))..))))))..(((((........)))))..)))))...))))))))))))))..))...))).((((((((((....(((.....))))))))))))).....(((..(((((...(((...)))..))))))))..(((((((((.....((..((.((((((............)))))).)))))))))))))))))))))))((((((..(((((((((.((.....)).)))).))))))))))))).)))).)))))).))))...(((((..((((.(((........)))))))(((((((((...((..((.....)).))...))).))))))((((..((((....))))))))))))).....(((((((.((((....))))))))))))))).......
Thermodynamic Ensemble Prediction
((((,.,,,,,,.||||,.|||||,.,((((((.(((..,,||||||||},,.{{{{{||||,,,||||{((.(((({(,(({(..{,||||{}((({{,....{((((((((.((((,{{.,||||,|,}}....}}}}}.((((((((((..........,,,{{.((((((((((((((....((((((((((((......)).)))))...,{,(((,{((((........)))))))).|(({(,...{{{{{...{|.||.,,..}})).,}}}}..}}....((((((.((..(((....)))..)).)))))){{((((..((((({{((((..((((,,{......((((...))))))},,...,))..))))))))))..)))),))|{{..,,.(((.(((((((..((((.(((((((((((((((((((((((((.(((((.((.....))..)))))((((({((((.(((((.(((......(((((....))))).{{(((((.{{((((({(((((..{.(((((((,{((((.........)))))))))))).}.))))).))..,)})))),,,.,|||,}}}),,,|.,,(((((.((({,(((.((.((.(((((((((((.,(((((.....(((((..((((((..(({,((((((((.(((.((((......((({((((((.((((.((((((....{((((.(((((....)))))((,,........}}}}((((((((..((((((....((((((,(.((((((.(........).)))))),,}.})).)))..)))))).........(((((.(((((((((((((((((((((((((.,.(((({(,,.))).))))}}}||,.,,.,.((((...((((({(((((.((.((((((((({.....{((({...((.(((((.,......,.....))))).))))))}...))))).))))).))))))).)..)))))..))))))))))....))))))))).)))).)))))...)))))))).(((((.....|...)))))..,,))))}.....((((....))))....,.)))))).)))).)))))).}.)))......))))))).)))))((((((.((.((((...)))).)).))))))...........))))))))))))..))))).,,..)))))((.((.((.((.,,.}}.)).)).)).,}.))))))))))))).)).))))))).)))))..,))).)))))..)))).}.)))))....))))))))))))..))))))))))))).)).))...))))))).))),)}},}}}.((((({...{(((((....)))))|(((...(((....)))...))),.(((....((((((((((.....(((((((((.(((((((((((.((((........)))))))))}.,).))))..))))))))){((,((((,((,((({{(({....,,)))..,.,,.....||||}..||..|,||,}}}(((((....))))).}||,.||},.|||,|,..{{(((.((((((((((((.(((((...)))))...)))))..)))}})))))))))))))),,,},.))))))))))....))).,))))))..(((((........)))))..)))))...))))))))))))))..}}.,,,}||{{{(((((((...|{((.,,.||||)})))))))||....{|{..(((((.,.(((...))),.)))))},}..(((((((((.....((..(({((((((..{,....}}..)))))),)))))))))))))))))))))))((((((..(((((((((.,{{,...)),)))).)))))))))))||||}}}..)))),.,,,,..,}},....{{||.|{(||,....,))))))))}}|.{||||,|||||{.,{{{....))).)))).))}))))||,.,((((....)))))}))))))).}}}.(((((((.({{{....}))})))))))}}))}}}}}..

Transcripts

ID Sequence Length GC content
GCUCACCUCCGCCUGAGCAGUGGAGAAGGCGGCACUCUGGUGGGGCUGC… 2097 nt 0.6505
Summary

Programmed cell death protein 1 (PDCD1) is an immune-inhibitory receptor expressed in activated T cells; it is involved in the regulation of T-cell functions, including those of effector CD8+ T cells. In addition, this protein can also promote the differentiation of CD4+ T cells into T regulatory cells. PDCD1 is expressed in many types of tumors including melanomas, and has demonstrated to play a role in anti-tumor immunity. Moreover, this protein has been shown to be involved in safeguarding against autoimmunity, however, it can also contribute to the inhibition of effective anti-tumor and anti-microbial immunity. [provided by RefSeq, Aug 2020]

Forensic Context

A study in mice demonstrated that the PDCD1 increased in lung tissue in both low and high LPS-induced sepsis groups, validating its role as part of a core seven-gene blood signature for differentiating sepsis-induced acute lung injury from sepsis [Sun et al. DOI:10.1016/j.ijbiomac.2024.136961].