Basic Information

Symbol
PDCD6IP
RNA class
mRNA
Alias
Programmed Cell Death 6 Interacting Protein AIP1 Hp95 Programmed Cell Death 6-Interacting Protein Alix ALG-2-Interacting Protein X PDCD6-Interacting Protein Apoptosis-Linked Gene 2-Interacting Protein X Dopamine Receptor Interacting Protein 4 ALG-2 Interacting Protein X ALG-2 Interacting Protein 1 ALG-2-Interacting Protein 1 KIAA1375 MCPH29 DRIP4 ALIX
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_013374.6
Sequence length
5884.0 nt
GC content
0.3904

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1536.20 kcal/mol
Thermodynamic ensemble
Free energy: -1653.78 kcal/mol
Frequency: 0.0000
Diversity: 1836.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........((((.(.((((((((((..(((((((.((((((((((((....(((((.((.((((.....)))))).)))))....)))).))))...((((((.((((((.((((((((((((((...((((((((((((((((((((((...)))((((((((...))).))))).........(((((((..(((((((((..((((....((((.((((((((.((..((...))...)).)))))))).))))(((((.((((...))))..)).)))))))..))))(((...)))((((..........))))....((((....)))).....)))))....(((((...))))).))))))).........((((((....))))))....))))))))))))..)))).)))........((((((((...(((((((..........(((((.(.(((((........)))))).))))).((......)).(((((..((((((.......................(((((((.(((((.......))))).)))))))..(((((((.....)))))))..)))))).))))))))))))))))))))(((.(.(((.(((((((((((((((.(((((.((.(((((........)))))....)))))))..)))))))......((((((((..(((((((..((......(((....((((((...))))))....)))..))..))))))).)))..))))).....((((((........))))))........)))))))))))).))))))))))))..((.(((((...)))))))....(((((......))))).....(((((...(((.((((((.....(((..............(((.(((((.((((((((.((((.......))))(((((.((((..((((......))))..))))..((((((......))))))....))))).))))))))))...((((........)))).........((((.((.((...........)).)).))))....((((...))))(((((((...((((.((..(((......)))((.(((((((.......)))).)))..)).((((.((((((((((..((((((((((((((((((((.(((........)))..))))((((((.....))))))..(((((.(((((((.(((((((((.((.........))))))...))))).))).))))...)))))(((((((.((((.(((((((.........((((((((......)))).........(((((......)))))))))..)))))))))))..)))))))...)))).)))).)))...)))))..))............(((((((((((((((((.(((((((............)))))))..))))))))).........)))).)))).((((((....((...))..))))))..((((..............)))).)))))))).))))...((((((((....))))))))...)).))))..)))))))......))).))).(((.......))).))).....)))))))))..)))))...))))).)))))).)))))).....((((..................))))((((((((((...(((.....)))....))))))))))...((((.........)))))))).)))))))..))))......(((((...(((((........))).))....)))))((((((..((....))))))))((((((((....((((((((.((((((((((.((....(((((...)))))((((((((((((.......))..))).))))))).)).)))))))))).))))).........)))....))))))))(((..(((((....)))))...)))...((((...((((((..(((((((((..((((((.(((((.((((((((((.((.(((((((((.((((((((.(((..(((....)))))))).)))))).)))..)))))).........((((.......))))..)).)))))))......(((((((((.((((((((..(((((.....)))))...(((((.(((((..(((((((..........)))))))((((((.((((((((((.((((((..((((((........))))))))))(((((.((((((.......(((.((.......)).))).............((....(((((((.........)))).)))....))......(((.......)))((((((.........((((((((((((...((((.((((((............).))))).))))...........((((((.(((.......(((((..........)))))((((((((((.(((....((((((....))))))...........((.(((((((...........))))))).))((((.(..((....))..)))))...)))...)))))))))).))).)).)))).............))))))))))))))))))............(((((........)))))((((......))))((((((.((((.((((......(((.((((..(.....((((((........))))))).))))...)))......)))))))).))))))((((.((.((((((((...(((((((...)))))))...(((((((((((.((....)).))))).))...))))((((((((((.((((..(((.......)))..))))..))))))..))))((((.......))))....)))))))).))))))(((((...)))))...((((((((((((((.........((..((((((((.(((((.....(((.((((((.......((((((...(((((((...........)))))))...))))))......((........))(((((((......)))))))(((((((((((...(((((((((((......))))))..))))))))).)))).)))........(((((..(((.(((((............((((((((.((.....(((((((((((((((...((((((((((((.((((((((..........))))))))......(((((..(((((.(((((...(((..(((((((.....................((((.((((....)))).)))))))))))..)))....))))).))))))))))(((((((((......((..((((.(((.((..(...(((((.(((((........))))).)))))...)..)).))).))))..))((((((..(((...))).)))))).(((((((((((((((((((..(((.....)))..)))).......(((...)))..........))))))..))))))))).((((.(((.....))).)))).......)))))))))....)))).))))))))...))))...((((((......((((((....(((((....(((((..........)))))..)))))....))))))......)).)))).......((((((.(((((((((.(((.(((....))).))))))))............)))).)))))).(.((.(((..(((((((....((....))....)))))))))).)).)...)))))))))))..)).)))))))))))))..))))))))((((.(.(((((((((((..((((..(((((....)))))........)))).)))))))))))).))))..)))))).)))......)))))))))))))..))..........(((....))).(((....((((((((((..........)))))))))).....)))((((((((.............)))))))))))))))))))))).....)))).)).)))))...(((((((....))))))).......)).).)))))))))...)))))).(((((.....))))).....((((((((((((((......(((..((((((.((((((((...(((((((.((((((((......................)))))))).))))(((((((((.....)))))))))...(((((..(((..(((((.(((.....)))...)))))..)))..))))).)))...)).)))))).)))))).)))....)))))).)))))))).......))))).)))))....)))))).))..))))))))).........))).)))))(((((((((((((((((((((((...((((........(((((((..((((((((............))))))))..))))))).)))).))))))).((((((...((((...))))((((((.((((((.(((((.....(((((..((((((((((..(((((...((((((((((((((((.((((..((...(((((...(((....)))....)))))......((((((((.((((...((((......(((((((((((.......)))))....((((((....))))))............((((..........)))).))))))...)))).......))))..))))))))....))..)))).))))))))))))).................))).........(((((......))))).(((.....))).....((.(((((((.((((((((((.(((.((((......)))).))).))......)))))))).))))))))).....)))))..))))))........))))..))))).....)))))..........))))))..(((....)))))))))....(((((.....((((......)))).....(((.........)))..)))))........((((.(((((....))))))))).))))))((.((((.((..(((((......(((((.......(((((.(((.(((((...((((....((((((((....(((((((.(((.(((.((((.(.(((((..(((((((((......)))))))))(((((.....)))))(((((....)))))(((....)))..(((..(..(((((......)))))..)..))).))))).).))))...)))...)))..))))))).....).)))))))..)))).))))).))).)))))...(((((..((((....((((((...................)))))).......)))).)))))(((.(((..(.((.(((............))).)).)..))).)))........((((.(((....))).)))).....((((.(((((((.....)))))))))))...))))).....)))))..)))))).))))))))))))))))))..(((((((((.((((((....((((((...)))))).....))).))).))))))))))))))))))))))))))))))...)))))))))).)))))....((((((((..((((.(((((((((...(((.....((((......)))).....)))))))))))).))))))))))))..................
Thermodynamic Ensemble Prediction
.(((((,.,(((..((((((.(((.((........,.,.||,|||,,,,....(((((.((.((((.....)))))).)))))})))))))))))))}.,(((((,(((((({(((((,{{..{{{{.....,,,|},},|}|(({({{,,((..((((((((,{((((({........))))),})}.}))))).,))..||||,}||||...(((((.((((((((.((..((...}}...)).)))))))).)))))|{{,,{{||}{{||,|.,||{||{||||{{||||{,{,..{{,((({{,,...,{{{|||{{(({((((....}}}}.,||,|,.......(((((...})))}{{{{{{(({({((({(({((,{((,.((((((((.((((.....))))))))))))}}|,,.....,((((((((...(((((((.,,.{{..{{(((((({{{((((,{{{(({.(((((....))).))},},}})}}}||,.,}|{{,{((,,.{,,{,.,..|||{||....|||{||{|,{{{|,,,,,,,))))}|,}}))}),,(((((((.....)))))))}})))))}.))}},)))))))))))))))|{{,(,((,....{{{{{(((((((,{((((.{{,(((((........|}|}|...,||||}}|,||}}}}}}.,,,,.,,{{||||..{{{{(((..{(..,,,,(((,,..((((({...))))))....|||,,||,,|}}|||},|}|,{|||},.....{(((((,,.,,,..|||||,{{{{....)))))))}},,,})),}}}||{|{,..}}.||||....})))}|}||,.(((((......))))),,.,,|||},....}})}}),.||,|}|||||||{,{,,,{((((({,....((.((((((({.((((.......))))(((({,{{{{..((((,....,}}}}..}}||.,((((({......))))))..,,))))).})))))))))...((((........)))).,,.,{{..{{{{,|{.,,..,,.},,...)})),.}}}|,,,,((((,,,}|}}{,|||||||.{|||.,|,,|||,.....,}}.{,(((({((......,))))}|||{{|,.((((.((((((((,((,(((({((((((((({(((((.(((.....,,.||}..}}))((((((,,,,,||}}||{{(((((,(((((((.((((({({(,(({(.....,.))))))...))))).))),})))...,),))|||||||.,,|{,(((((((,.,.,,,..,,,{((((......))))...,,,,,.|||{|,,,,,.})))},))}}}}))))))})))}.}|||||}...,}}})))))|||},..}}}|||.,}......,.....{{|||,,((((((((((.(((((((............)))))))..))))))))))...,,...,})),})),.((((((.,..{{...)}.,))))))..{{{{,,,,{{,,,,...,|}||,}))))))).)))).|.((((((({....)))))))).|||||}|||{{||,,|||,.....,,|||}..})),}}}}}}},,..,.}}}}||||,,}},,,,))}}}.)))))}|,))))}).))}}}}.{{{{{((({..{{{{{{{,..,,{.,(((((((((((((({{,(((,,,,,|||,{{,|||||||{|(({,,,{{|||,.{{,,{{((((((..((((((((((((((({.{(((((...(((((........))).))....)))))|{(((,.,((....))))))},((((((((.,..((((((((.((((((((((.((....{{{{|...}|||,((((((((((,,..,....})..)))},)))))).)).)))))))))).))))).........)))..,.)))))))).....(((((....))))}....(({((((((((((,{((((...,....}}}}|(((((((((((...((((((((.((.(((((((((.((((((((.(((..{{{....}},)))))})))))).)))..}))))).,,,.....(({{...,...})))..)).)))))))).,,,.((((,(((({.((((((((.(((((.....)))))...{((({{((......|}|.((({{({((({{(((((|...,,,{,.{,,(((({{(((((.(((((((..,,,,{..((((((..{{...}|..}}}}}}.......(((((............{,......{{.(((((((((((((((((.........)))).))}...{{{{....,(((.......}}}..|))}..........})))))))))).}}((((.((((((............),})))).))))............))))),(((,...,,,,.|||}..,,....,||,,.((((((((((.(((....((((((....))))))...........{(.(((((((.,........}))))))).)}((((.(..((....))..)))))...)))...)))))))))).....((((...........,(((((((.{,.......||,{..{(({(.......,.})))}...|,|||,(((((......)))))..}}},,..))))))).)...........))))....((((((........))))))}))))....||...,},}..,,.,))))))))))))))))}......(((..(((((((...)))))))...}}}.(((((((.((....)).))))).))..((((((....))))))....}}}}}})}..,,|||||{|||||,,.||||,|{{|{{{{.......}}}..{{{.(((((((((((..{{((((,..||}}}|,.,.{{,,,,.,{{{{,.....{,,((((.((((,.((((.............})}).,}))).)))},,,,,,{(((({{,...,},..,})))}}},.})}}}}}}},....))))))))))))||{((((......))))}|,,,,((((((((...(((((((((((......))))))..))))))))),,))).)))}.})))..,}}},.,||}}}},}},,,,,,,.......,}}))))))}..}}}}}...{{{{(,{{{,{.,,|,.,,,||||...))))))))..))))).)))}.}}}.....|{{{{|..(((((.{((((.,|{{{,.(({{(((,..,....,............((((.((((....)))).))))}}})))}..}}}....))))}.)))))}}}}}}(((.((.{((.....)),.)).))|.}))))))))}||((,(,((({{......}}))),),))),..))))))))))))),})))))))|.....(((((({,,,.,,.....},,,.})))))}..{((((((...,.{{{{............|||}..||{{,{..{{{{{...,,,)))))}))))}))))))|,{.....,)}.))))))).)))))))},,,,.|}|}|{|||||,,,|||}}}}}|...,{{{||....,}||||{({{{{((((({({,,{{{{,......{{{{{,,||||||||,...}}}}}},}}.}}})}},|,..{((((((((({,(((((((((.(((.(((....})).))))))))...........,{{,{,,,,,,,}|}||.,,,..(((((((....{{....})....))))))),||{{|.,{{{{|||{{{||||.{{{(({{((((,,.{,((((...{{{.{{{({.((((((((((((..((({.,(((((....))))).,.....})).,.))))))))))))),)),..........,,........}))}}}.}}}}.},,,})})))))},,,|||||,||}}}}}},}))))),))))}.....)))))))))))))))...)).)))})))))}}}....||||,{{{{{{((({{{{{{{||((((,...((((,,{{{{{((((({(((((((....)))))))))))}..{{{(.{{(({((({((({({{{{|||,||.......,,,,,}}},}||||{{({{{{{{{|,.|||,,,(((((({{..{((((((..((((((.((((((((.....,........,.......)))))))).)))))},,,))))))}...,,,,||((((((((((({{(((({{({....,{{(.(((((...{{{{|,....{((((.....,|,|((((((((((((,.....{(((.(((((((((((({({........{(,(((((((..,,{{({{{.,....|,|||,.,.,{{..,...,,....)),,}||{{,{.,|||,.(((((((...((((........(((((((..((((((((............))))))))..))))))).)))).)))))))..(((((((((....))).))).))).}})).})))}},}}}}}}}.}}....,..((((((..(((((...{{{(((((((((((((.((((..{(...,{{{,{{{{.......,,...,,})},,,,,..((((((((,((((...((({......((((({{((((.......)))))....((((((....))))))............{{{{..........}})}.))))))...,,}}.,},...))))..))))))))....}}..)))).))))))))))))).................}},.........(((((......))))).(({.....}}).....((.(((((((.((((((((,,.({(.{(((......})}}.))}.,,......}))))))).))))))))).....)))))..)))))).....}}}.)))))))))))}..))))))))))))))))},,,,}}}|}|}}}}......))))).)))))}}....,{{{.....,)))})))))))).)))))))),,}}))))))),},,,}}||||,|||||,,,})),)))})),.|||}},,.((((((({{.......,,.,,{{,.......,,})))))))))}..,...|||{...{(((({{,.||}}}||},||,||)))||}}}}..,.,|||}},(((((((((......)))))))))..|}}}},},}))))}}))}}},.,})))|||,..}})),,}}}}}}},||{{{......)))}|,|}},....}}))),}}))))},,}}}})))}))))))))))}}},||||,}}}{||||||||.}}}}|}}},}.})})))})))}.,}}.,,)|||..,,))),,,,..,.,,,,,,}}}}})))))}}}|.,.,,}|,.|||,,.{(((........))}}....,,.....))))})},)))}}}}},,.,{||||{{{,|{.,,,,{.{(((,|,..,||||{,||||{{|.,...})))))}})))..,}}}}}.......,,,{||||.......||||||}|||||,||||(((((((((,(({,,,.,{,{{{{{,,..,}}|||,,,,.|||,|||.||||||||,........}}}))))))),.........}}))))}))}))}}}.,{{|||||..|||,.(((((((({..||||.....((((......))))...,.))))))))))))}}))))))})))},,,,},}},..}}},,,.

Transcripts

ID Sequence Length GC content
AGUCAGUCCGCCAGUCCGCCAGCCCAGUACCUCUCUCUCCUCGGCCCUC… 5899 nt 0.3899
AGUCAGUCCGCCAGUCCGCCAGCCCAGUACCUCUCUCUCCUCGGCCCUC… 5884 nt 0.3904
Summary

This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]

Forensic Context

A study in mice demonstrated that exosomes isolated from serum 24 hours after total body irradiation (Exo-IR-24h) exacerbated radiation-induced intestinal injury, promoting apoptosis and DNA damage while attenuating the Nrf2 antioxidant response [Li et al. DOI:10.1038/s41401-021-00615-6]. In separate research, the PDCD6IP was validated via Western blot as an exosomal marker for brain-derived extracellular vesicles isolated from mouse and human plasma using a nanomagnetic platform, which achieved high diagnostic accuracy for traumatic brain injury through machine learning analysis of EV miRNA cargo [Ko et al. DOI:10.1039/c8lc00672e].