| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCGGAGGAGACCCUGCGGCGCGCGGCGGCGGCUCCCGGGCGUCCCGG… | 2192 nt | 0.5502 |
The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
A study in human patients with severe heat stroke demonstrated that serum exosomes contained significantly increased expression of the PDE9A mRNA, which was associated with the blood coagulation pathway [Li et al. DOI:10.3389/fimmu.2021.624753].