Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCAACUUCUCCUCCUGCAGCCGGGAGCGGCCUGCCUGCCUCCCUGCGC… | 3728 nt | 0.6060 | |
| AGAGAGAGAGAGAGACUGACUGAGCAGGAAUGGUGAGAUGUUUAUCAUG… | 2701 nt | 0.5642 |
Summary
This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit B, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit A. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Mutations in this gene are associated with meningioma. Reciprocal translocations between chromosomes 22 and 17, at sites where this gene and that for collagen type 1, alpha 1 are located, are associated with dermatofibrosarcoma protuberans, a rare skin tumor. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] CIViC Summary for PDGFB Gene
Forensic Context
A study in mice demonstrated that the PDGFB was mentioned in the introductory and discussion sections as collaborating with IGFBP2 in glioma development, but it was not experimentally studied in the context of radiation-induced gene expression changes in liver cells [Roudkenar et al. DOI:10.1269/jrr.07078]. In rats, research on blast-induced traumatic brain injury identified the PDGFB as an mRNA marker for fibroblast proliferation, showing it was elevated at all times after a 14–15 psi blast exposure [Carey et al. DOI:10.1016/j.jneumeth.2016.02.001]. A study in rats demonstrated that the PDGFB mRNA was elevated at all measured time points (2, 24, and 72 hours) following a 14–15 psi blast exposure, identifying it as part of a fibroblast proliferation response to more severe vascular injury [Balaban et al. DOI:10.1016/j.jneumeth.2016.02.001].