| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCCCGUGCGGAGACGCCGCGCGUAGCCCCGAGGUUAGCGCGGAGCCCG… | 4570 nt | 0.4365 |
The protein encoded by this gene is a member of the platelet-derived growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines. This gene product appears to form only homodimers. It differs from the platelet-derived growth factor alpha and beta polypeptides in having an unusual N-terminal domain, the CUB domain. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
A study in humans demonstrated that platelet PDGFC mRNA expression was negatively correlated with platelet aggregation to ADP in patients with acute myocardial infarction [Eicher et al. DOI:10.3109/09537104.2015.1083543].