| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACGUGGCACCGGGAACUCGGAGGCGGGGAGCGGCUGGGAAGUGGCCG… | 1844 nt | 0.5228 |
This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, three catalytically active thioredoxin (TRX) domains, a TRX-like domain, and a C-terminal ER-retention sequence. The N-terminal TRX-like domain is the primary binding site for the major ER chaperone calreticulin and possibly other proteins and substrates as well. Alternative splicing results in multiple protein- and non-protein-coding transcript variants. [provided by RefSeq, Dec 2016]
A study in humans demonstrated that the PDIA5 mRNA was up-regulated by 76% in pericontusional brain tissue from a patient with traumatic brain injury (TBI) compared to control tissue, indicating its differential expression in the context of neural trauma [Michael et al. DOI:10.1016/j.jocn.2004.11.003].