Basic Information

Symbol
PDK4
RNA class
mRNA
Alias
Pyruvate Dehydrogenase Kinase 4 [Pyruvate Dehydrogenase (Acetyl-Transferring)] Kinase Isozyme 4, Mitochondrial Pyruvate Dehydrogenase Kinase, Isoenzyme 4 Pyruvate Dehydrogenase Kinase, Isozyme 4 EC 2.7.11.2 [Pyruvate Dehydrogenase [Lipoamide]] Kinase Isozyme 4, Mitochondrial Pyruvate Dehydrogenase, Lipoamide, Kinase Isozyme 4, Mitochondrial Pyruvate Dehydrogenase Kinase Isoform 4 EC 2.7.11 PDHK4
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Other applications

MANE select

Transcript ID
NM_002612.4
Sequence length
3601.0 nt
GC content
0.3943

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-937.50 kcal/mol
Thermodynamic ensemble
Free energy: -1007.26 kcal/mol
Frequency: 0.0000
Diversity: 994.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..........(((((((((((((.....((((((..((((((((........(((((((((.((((((...............(((((((.((.....(((.(((((((((...(((.((((......))))(((((.(((((((((((.((..((((..(((..(((..((....))..))).))).))))...))..)))..)))..))))))))))..........(((((.((...)).))))))))))))))))).))).....)).))))))))))))).)).)).)))))(((.((((.((((.(((((........))))).......(((....((((((....))))))....)))((((((((((...))))))))))....))).).)))).)))(((((((..((((......((.(.((((........)))).).)).((((((.(((.............)))))))))......((((((...(((((((.(((((((((((((.(...(((.....)))...)))))))............))))))).))))))).......((((((..((((((..((((..((((..(((((...)))))))))....(((.(((............))).)))(((.((((((.((((..........................)))).)))))).)))............)))).))))))..))))))))))))...............)))))))))))...((....))..(((((((((((........))).......)))))))).)))).))))..)))))).)))))).)))))))((((((........)))))).(((((((((............((.(((((..((((((((((...)))))..........)))))...))))).))(((((((..((((..((((...(((((((((.(((((....(((((..(((((((..(((((...((((...((((((((((((((..(((.(((((.....))))).)))...)))))..((((..((((....)))).)))).(((.(((((((((((((((......)))).....))))))))))).)))..........(((.((......))..)))..(((....))).(((....)))...)))))))))))))..))))))))).......))).)))))...)))))..))))))))).(((...((((((......((((((...(((...(((((....)))))......((((((........))))))....(((((((...))))))).....(((((((((((((...((((......(((((.((((((.....((((...((((.....))))))))....(((((((((...(((((.((.........))((((.((((((((((.....(((((......))))).....)))).....)))))).)))).(((((((((...((((((......))))))..(((((....(((((((((((((((((....)))))....)))))).(((.((((((((((..(((.((((((....((((.....)))).(((((((..(.....)..)))))))((((((.......)))))).)))))).)))...............)))))))))).)))))))))...)))))........((((((((((((.(((....((((((..(.(((((..((((((.....)))))).........((((...(((((((((((......)))))))..))))((((((((((.(((.((((((...........((.((((....)))).))....(((...(((((((((........))).))))))...))))).)))).)))))))))))))......((((((((((.((((......))))))))))))))..........((((((((.....))))))))............(((((((........))))))).))))....((....))......(((((.(((....))))))))....))).)).)..))))))...))).))))))))))))..)))))))))........))))).))))))))).(((((((((((((..(.(((.......))).)..)))))))))..))))...(((((.((((((((.....(((((....(((((((((.((((..((((((..(((((....))))).))))))(((((....((.((.(((((((.((((............((((((..(((.....))))))))))))).).)))))).))..))....)))))((((.............))))..)))).)))))))))...)))))......))))))).).)))))((((....)))).(((((((((((((((((((((..((((.........))))))))))..............))))))..)))))))))..))))))))).))....(((((((((((((..(((((((((..(((((.(((((((.........))))))).)))))..))))).)))).))))))......)))))))..))))...)))))))))))))...)))....).)))))......))))))...))).........))))..).)))..)))))))........((((((.((((((.(((((((.((.....(((((......(((((((((.....(((((((.((((........)))).))))))).......((((.((((((..((((.(........).)))).....))))))...))))(((((..(((((......)))))...)))))......((.(((..((((((((((((((.((((((((((..((((((((........))))))))...))).............))))))).)))))))..)))))))..))).)).(((((((((.((((((((....(((.(((((((..........))))))))))))))......((((((((...((((((((.((((((..((....(((((((((((((((.(((((.((((....((....))..)))).))))).......(((((((((((.(((.....((((((((((.....)))))))..)))....)))..........(((((((....)))))))....(((....)))((((((((....))))))))....)))))))))))...((((......))))...)))))))))).(((.......)))....)))))......))..))))))...))))))))))))))))..)))).))))))))).)))))))))((((.((..(((.((((......)))))))..)).))))..............))))).....)).))))))).))))).).))))))...(((((((......)))))))...(((((.....)))))))))))))).
Thermodynamic Ensemble Prediction
..........(((((((((((((.....((((((..((((((((......,{({(,(((((.(((({,.............,{(((((((.((.....(((.(((((((((...{((,((((......))))((((({(((({{({(((,....((((..(((..(((..((....))..))).))).))))...,}..||}..,)),.)))})))))},.....,..}|||||,}}},.}),))))))}.))))))))).))).....)).))))))))))))).)).)))}}))){((.((((.((((.(((((........))))).......(((....((((((....)))))).,..)))((((((((({...))))))))))....))).}.)))).)))(((((((..((((.,.....{.(,((((........)))).,.}|.((((((.(({.........,.,,})))))))),.....((((((,,.(((((((.(((((((,((({((({...,|,,,..},....,}},}}}.,}}},......})))))).))))))).,,....((((((..((((((..((((..((((..(((((...)))))))))..,.{((.{({,,,,.{{{{...})}.)))||,..(,((((...)))}......,,,{{{|{,,,.....,))))},,)))),},,..,....,,...)))).))))))..))))))})))))...............)))))))))))...((....))..((((((((({{........}}}....,.,)))))))).)))).))))..)))))).)))))).)))))))((((((........)))))).(((((((((............((.(((((..(((((((({....,}}},......,,.,))))).}.))))).)}(((((((..((((..((((.,.((((((....{.(((((({.,{,(((,{({(((((,{{{{...((((,..{(((((((((((((..(((.(((((,...,))))).)))...)))))..({((..((((....)))).}))).(((.(((((((((((((((......)))).....))))))))))).)))..........(((.((......))..)))..(((....}}).(((....)))...)))))))))))))..}||}|{(((((({{.{{{...,(((((.....{(((((,,(({{,,..{{{(((((({.,..{(((((,.{,((({,,,{,{({{{{|||||.,{{{.((((({.{,,,,,,))))}}.,||(((({{{,,,|||||||.....(((((((({{,..,,{(,,,.||}},..,.}))))))))).{{(((({{{,(((,..,,||}},,,,....,||||{{,,...,{{((,((.,((({{{..{..(,,.,.},,},}}}}}}}||,||,...}})),.)}}})))))|{||{|||||,,.,||||{{{{{{{{{,..{{{{{{......}})))},.{{{{{....(((((((((((((((((....)))))....)))))).,{({((((((((((,,{{{.((((((....{{{(...,,|||,,(((((((..{....,,..})))))}{{{{{{....,,,)},,}},)))))),)))},,.,,,.....}},)))))))))),))}))))))..,||}}|{||....,|||{{|||{|||,|||,|||{{{{|||,||||||,..{{||||,,...}}})))}}}.,{{{{{{|,.,{{({{(((((({......}))))))..},,|((((((((((((((.((((((,.,{,,.,,...|}||||,,.{||,..))},..{((...(((((((((........))),})))))...))))).)))).)))))))))))))}..{,,((((({{{((,((((,,,,,.}}}}}}}}}}}})),...{{{{{,,((((,((,,{{,|||}}}},............(((((((........))))))).{|||{{{.,,....||......(((({{(((....))))))))....,,,.||{|...,,,,,...)))}}})))}}}}}}}..||}}}|||.,||||...})))),,))),,)))}}}}.,,|||||||},|.|||,.,,.,})),.|,,}}})}}|||{{|||||,|{{{{({(((({{{((((...,,,,...||||.....|}||||,,{{((((..(((({....))))}.)))))}{((((....((.{{.((((((,.((({............((((((..(((....,)),)))))))))).}.)))))).}}..}),,..))))},||},.,,,,,,}}},}}}},..,|{{{{(({{..,}}}}))))}......,})))}),,.)}}}}||||,.,,}}|},||{{{{{{{,,((((((((((..((((.........))))))))))..}}},.,}})}}}))))))}})))))))))...,))))))).)),})))))})..{(((((..(((((((((..(((((.(((((((.........))))))).)))))..))))).)))).))))))}}})..))))))....)))))...)))))))))))}}.)).))))).))}))}.,))))))),..}.,}),..},....))))..),}))..)))))))......,.((((((.((((((.(((((((.((.....(((((......(((((((((...{{((((((({(.....{{{{{{{|||.|||||..,{,....((((.((((((..,{((.((({,...,)})),),.,..))))))...)))),,|||,}}|}|,}}}}}},)))).}})))))}}}}..((.(((..((((((((((((((.((((((,(({..((((((((........)))))))}.,,||}..........}}.})))))).)))))))..)))))))..))).)).(((((((((.((((,(,((({.,((.(((((((,,..,{{,{,|||||||{,{|{{{{......}}||,||,.,}}}}}}}}}}})})))))})..||}|.||{(((({{{{.|{{((,((((,...{|....)),.}}||,}||}}.......{(((((((((({{{,,.,,.,,((((((((.....)))))))}.|||{,{,{{{{{{{{{....(((((({....)))))))....{{{....,}}((((((((....))))))))....}})))))}}}}...((((......))))...})))))))))),}.,}|||..,.{{{....,))),}},}},..}}})}}....}}|}}}},,})}))},.)))).))))))))).))))))))}((((.((.,(((.((((......))))))),.)).))))..............)))))...,.)).))))))).))))).).)))))).}.(((((((,,....}}}}}}}...,,,,|,,,,}))),,))))))))).

Transcripts

ID Sequence Length GC content
AAGACUUGAACUUGAAUCUCGAACCACUGCAUCUCCGACUCUGCCCAGA… 3601 nt 0.3943
Summary

This gene is a member of the PDK/BCKDK protein kinase family and encodes a mitochondrial protein with a histidine kinase domain. This protein is located in the matrix of the mitrochondria and inhibits the pyruvate dehydrogenase complex by phosphorylating one of its subunits, thereby contributing to the regulation of glucose metabolism. Expression of this gene is regulated by glucocorticoids, retinoic acid and insulin. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the PDK4 protein level was increased in subcutaneous white adipose tissue following acute cold exposure and in differentiated 3T3-L1 beige adipocytes, identifying it as a brown adipocyte marker involved in the transcriptional response to cold stimulation [Liang et al. DOI:10.3390/ijms20163968]. In humans, the PDK4 gene was specifically enriched in high oxidative stress cardiomyocytes following acute myocardial infarction and, as part of a five-gene panel, demonstrated stable diagnostic capability for AMI with an AUC of 0.688 in independent validation cohorts [Hu et al. DOI:10.3390/antiox14121435]. A study in humans demonstrated that a 7-day overfeeding intervention in lean and obese men induced differential expression of 45 genes in abdominal subcutaneous adipose tissue, with pyruvate dehydrogenase kinase, isozyme 4 (PDK4) identified as a key obesity candidate gene [Shea et al. DOI:10.3945/ajcn.2008.25970].