Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGACUUGAACUUGAAUCUCGAACCACUGCAUCUCCGACUCUGCCCAGA… | 3601 nt | 0.3943 |
Summary
This gene is a member of the PDK/BCKDK protein kinase family and encodes a mitochondrial protein with a histidine kinase domain. This protein is located in the matrix of the mitrochondria and inhibits the pyruvate dehydrogenase complex by phosphorylating one of its subunits, thereby contributing to the regulation of glucose metabolism. Expression of this gene is regulated by glucocorticoids, retinoic acid and insulin. [provided by RefSeq, Jul 2008]
Forensic Context
A study in mice demonstrated that the PDK4 protein level was increased in subcutaneous white adipose tissue following acute cold exposure and in differentiated 3T3-L1 beige adipocytes, identifying it as a brown adipocyte marker involved in the transcriptional response to cold stimulation [Liang et al. DOI:10.3390/ijms20163968]. In humans, the PDK4 gene was specifically enriched in high oxidative stress cardiomyocytes following acute myocardial infarction and, as part of a five-gene panel, demonstrated stable diagnostic capability for AMI with an AUC of 0.688 in independent validation cohorts [Hu et al. DOI:10.3390/antiox14121435]. A study in humans demonstrated that a 7-day overfeeding intervention in lean and obese men induced differential expression of 45 genes in abdominal subcutaneous adipose tissue, with pyruvate dehydrogenase kinase, isozyme 4 (PDK4) identified as a key obesity candidate gene [Shea et al. DOI:10.3945/ajcn.2008.25970].