Basic Information

Symbol
PECAM1
RNA class
mRNA
Alias
Platelet And Endothelial Cell Adhesion Molecule 1 CD31 Antigen CD31 Platelet Endothelial Cell Adhesion Molecule PECAM-1 EndoCAM GPIIA' PECA1 Platelet/Endothelial Cell Adhesion Molecule 1 Platelet Endothelial Cell Adhesion Molecule-1 CD31/EndoCAM
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_000442.5
Sequence length
6813.0 nt
GC content
0.4930

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2397.90 kcal/mol
Thermodynamic ensemble
Free energy: -2522.86 kcal/mol
Frequency: 0.0000
Diversity: 1767.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((..(((....)))..)))......(.(((((((((......(((..((((((((.((((..((((((....(((((....)))))))))))....))))((((((((..(.(((((((((.(((((......)))))..))))))))).).....(((((.(......).)))))(((.((((.......)))))))(((((..((((.((....)).))))....))))).(((((..(..((((((((..(((.......)))...))))))))..)..)))))((((((((((.((((((((((((.......((((.(.((((.(.(((.((....((......))))))).).)))).)...)))))))))))).....(((((..((((..((((((((.....))))).......))).))))(((((.(((.................))).))))).))))).........((((((.(((.........)))))))))((((....)))))))))))))))))).......))).))))).)))))))).))).))))))))).).(((((((....((((.((.......))))))......(((((.(((...(((((((((.((((((((...(.(((((...))))).)...)))))..........((((((((.....(((((.(((..........))))))))((....)).(((((...)))))..(((((..((.(((((((..((((....((.(((....))).))....((((((.((((((.(((((..((((.((.........(((((((.((((..((((......(((....))).......))))..))))..)).))))).........)).))))..)))))...((....)).(((((..((((((((((...)))))......(((.(((.......))))))..((((...))))...)))))...)))))......)))))).))))))..((((..((((......((((((..((.(((((......))))).))))))))))))..))))(((((.(((.(((.......))).)))...)))))...))))..)))).))).))..)))))..................((((.........))))((((((((.......((((((....((((((....((...(((...((((((......))))))....))).))..)))))).)))))))))))))).))))))))........))).)))))))))..))).)))))..(((.((((((.((((.(((((.(((((((((((((.(((((......))))).............((((.....(.((((((((...((((..((((((((..((..((((((....(((((.((((((((.....(((..((((...((((((((((((((...))..)))))).)))))).(((((.(((...((((((...........))))))...))))))))......(..((((((((..((((((((((((...(((...............)))))))))).((.((...)).))..(((((.((((((((((((.(((((..(((.((((((.((((.((.(((((((((....(((((.((((((((((((((...(((........)))....))))))))).(((((((((((...))))))(((((((..((..(((.(.(((....(((...((((((..(((((((....((((((.....)))))).........((..(((((((.....))))))).))....(((.....))).....((((((((((..(((((..((((((...((((...(((...(((.....((((......(((.((((((......((((.((((..(((((.(((((.((....)))))))..)))))))))))))(((......((.((((((((.........)))))))).))))).........)))))).)))......))))...((....))...)))...)))..))))..))))))..)).)))...)))).............(((.((...(((...)))...)).)))((((((........))))))((((((......(((....((....))....)))........(((((((((..((.(((..(((....(((((....(((.((((((((..(((.((((.....)))).)))....).)))))))...((((((...(.(......).)....))))))..)))..)))))....))).....)))))..))).))))))(((((.((.........)).)))))((((..........))))...))))))..))))))..((((.((((.......)))).)))).....))))))).))))))...)))....)))..).)))..))...)))))))..))))).(((......)))(..((((...((.((((.((.........)).)))).))..))))..).(((((..(((.(......).)))..)))))(((((((((((..........)))))....)))))).((((((((.((...(((((((...))).))))(((((((........))))))))).))))))))..........))))).)))))((((((((.(((..(((((.....)))))...........(((((((((((((.((.....)))))))))).)))))...((((((..((((.((.(((((......(((((.((((..((.((((((((((((((((.......((.((((......)))))).......)))........((((((((.(((((...(((.....)))......((((((((.((.((((((.........((((((((......)).))))))........((((.(((((..((..(((((.((((.((((.((.....)).)))).)))))))))..))))))).))))..((((((.((((((.(((...................))).)))))).......(((......))).........((((((((........(((((((.....((((.((((..(((.(((..(((..(((((((((.(((((((((((((((((((...((((((((((.(((.(((((((.((((.((((((((((((((((((((((.((((((((((((((((((((((((((((((((((((((((((((((((((..((((((((((.((((((((((..((((((((((.((((.....((((((((((((((..(((((((((((((((((((((...(((((.(((((.(((((((((.(((((((((((((..(((.((((((((..((((((..((((((..(((((((...((((((((((((((....(((((((((((......)))))))))))....))))))..((((((.(.((((....((((((....)))))))))).)..)).)))).......))))))))(((((.......))).))(((((((((((((((....((.((..((((.....))))..)).))....).)))))))))..)))))...........(((((((((((.((.((((.....)))))).)).))))))))).(((((......))))).......)))))))......)))))))))))).)))))))).)))..))))))).)))))).))))))))).))))).)))))...)))))))))))))))))))))..))))))))))))))...))))...))))))))))..)))))))))).))))))))))..)))))))))))))))))))))))))))))))))))))))))))))))))).......((.(((((...........))))).))..(((((((.(((((((....((.((((((.((...((.(((..(((((((((((..((..(((....)))..))..)))))))))))..))).)).)))))))).))..))((((((.........)))))).......((((((((((((.((......)).)))))))))...)))((((((.(((((((.....((((((((....(((.((....))))).....(((......)))((....)).(((((((......)))))))(((((....)))))....)))))))).....))))))))))))).)))))))))))).(((..((....))..))).......(.(((((((((((((((.(((((((.(((.((((.....)))).))).)))...(((((((..((((.(((((.((..(((((((.(.((((((.(((((.((....)))).))).)))..))).)...))))))).))))))).)).))..))))))).((((((....)))))).....(((....)))((((....))))...................))))))).)))))...))))).)).)..)))))))))))))))))))))).)))).))))))).))).))))))))))...))))))))))))))))))).))))))))))))))))))....))))...))))......))))))).(((((((((.............)))).)))))...)))))))).((((((........))))))..(((((.....((..(((((.(((......(((((.((..(((((((..((((((((((((......(((......))).(((((.(((..((((......)))).))))))))...(((.((..((((....))))...)))))(((((((((((((((((((.......))))..(((((((......))))))).((((((((.(((((.........((((((........)))))).((((............((((((....((((.(((..(((((......))))).))).......(((((((.(((.((((((.((...(((((.(((((((((......))))...((((..(((((...(((.(((((.((((.(((...))).)))).))))))))...)))))..)))).....))))).)))))..))))))))))).(((((...)))))..)))))))....))))...))))))............((((((((((...(((......)))...((((((((((((.......((((....))))...((((((((((...(.((((((((.....))).)))))).)))).))))))..))))).....)))))))))))))..))))..))))))))).)))))))).)))))))...))))))))....)))))))))))).....)))))))..)).)))))...))).)))))..))....))))).............(((((....))))))))))).........((((......)))).)))))).)).))))))))......((((((((((((((......(((....)))...)))))))).))))))((((..((...))..))))......)))))...))))))))))))))))...)))))...))..)))).)))))))))).)).)))).)))))))))))))))))...((((((.((((..((((((.....((((........)))).....))))).)..)))).....)))))).......))))))))).)))))).))))))((((.((((((......))))))...))))....((((((((((((((((((((.(((....(((....))).))))).)))).((((...))))))))))))))))))))).)))))..))))))))....((((....((((((...))))))....)))).((((((((........))))))))....)))).)))))...((..((((....)))))).))))).))))))))..).))))..)))......)))))))).))))).(((((...)))))..((((...((..((((((.(((........(((((((((.(((.((((.(((((....)))......((((((....))))))..)).)))).)))..))))).))))...........((....)))))))))))..))...))))((((......))))..........((((((....))))))..........))))))..)).)).))))))..))))((((((.((....)).))...))))....(((..........))).....((((((.((((((....)))).((((...(((.((((((....((((.((....))))))(((.(((....((((......))))))).)))..))))))))).)))).)).)))))).))))))))))))).)))))).....(((.....((..((((.............)))).))..((((.......))))....))).......((((((((((((..((((((....)).))))..)))))))))))).)))))))))))).)))).))).))).)))......................))))))).........
Thermodynamic Ensemble Prediction
.({,,...(((.(((((.((..((((((((..((.((((((((((((((((.((....)).)))))).((((..((((((.....)))))))))).((((((,...(((,.{.(((((((((.(((((......)))))..))))))))).|{{....}||{{......}}||(((((((((((,{{{{..,,,,,(((,(((((((.(((.....(((((...((((((((((((,({..,..((((((((..(((.......)))...)))))))),||..,,)},{(((((((({,((((((((((((,..((((((((.((,,,{,..||{.{.....{{,.....)),,.,)).)))).))))..}..))))))))},...(((((,,((((..((((((((.....))))).......))).))))||({(,(({.....,...,..,,...)}),)))}}.)))))........,(((((,{(((.........)))))))))|{{{....}))},})))))))))))}......((((((.....(((((..(((((((.,.(((((((((((..(((...((((((((((((..((((.{.........{((,,,...))|((.((((.((((({.(((.((((((((((((.((..,,,.,,,...,.,.,{(((....})}}...(((({,(((..,.......))))))))((,....|,((({,...}))))....,|||.{{{,,}})}}.,}))..}},.)).))).))},))))))...)))..,}))))})))).))..,))))..)))}}})))))))......)))..))).....)))))))).,.....))))).))..)).))).....))))))...,)))))..))))))).))))),,.,(((((.|{((.,{{(((((...)))))...}}..))).|.)))))..}}|{.((((.(((((((((((((({,.,.........,}}....}},....((.((((((..((((......((((((..((.(((((......))))).))))))))))))..)))))).)).....(((.......)))(((.(((((({{..,,(,,.|||.,||.{(((((((({..........,.......{((({.{......}))))}.,,(((((((({(....((((..((((..........))))))))((((((......)))))).((((((...((((((((((({.,..}}|.(((((....)))))...,...,....,((((((..,{.{((((((.....{(,({((((((.(((((((((((,{(({(((((((((..(((((....,...{(((.((((..{.......,,}..))))...)))).,,,,.,,...||{{,((((.{(({{((((({{(({({((......{{...||}}.,||||||||{{{{{|...,|,,||}}}|,.}}|}|.((({{{(({...((((((...........)))))}..,))))))))...,,,}..}}}},,,}}}}))).)))}}},.,}}}.....)))))......)))}))))))..))}}.))))))))..)))...)))))),}}....}},,...))))))),}...)))))}|{{{{,{|},..,,{((({,,,}||||,,,,||}}}|||.,,......)))))))))))))))))((.(((((((...))))))).)))))..})))))}((((((((((.{(((((...(((((((((.,....,(((((,...,||||||.......{.{(,.(((((((.....))))))).))..,..,,,|||||{(((...((,(((((.(((((.((...,((({{,((((({....{(,({{{{{((.(({{{..,,,(((.((((({.....{((((.((((..(((((.(((((.((....)))))))..)))))))))))))|{|,....,((.((((((((.........)))))))).))},....,,,...,})))).))}.(((({{(((((.((.,,.(((,,((({....}||||||((({{{{...}}},|||,.{{{.......}}}....,{|}||,,,{,,.,{{||...{{.{{{((((((........))))))..})).))...})))}...,|....,.....,||,,......(((((((((,,((,{{{,{(({....||||{..,|||,.((((((((..(((.((((.....)))).)))....),})))))).{.{{{(((,,,{,(.,..,,|,,,,..|||}||,,||,..}))}),,.,))}.....|||||..}|||,|||||(((((.((.........)).))))){{,|,.||.,.,|||||||.((({{....}}}})}..((({.((((.......)))).))))..},|{{||||||,,,.,{{{{.((((({((..((,({.....}}.}}..}}}........(((......)))))))).)}}}},.,,,,.(({,.,..,,{||{||||{|{{{{{{,....(((((..(((.(......}.)))..)))))(((((((((((..{......,)))))....)))))).||||||||||...}||||||{...))).)))){((((((........))))))),,.,,,.(((((,,((........,},))..)))))..,,......,{{{,.....}})))}}}},.}}}}}}).)))).})})))).)))))))))}.))))))))),....,,,.....|,||||,.,,}},))))))))}}))|||||}|{{|,|||||||,,,}}}...,}}.)).)))).,)))}..))))))))))))})}.,))}.}.}}},}}||||{.,,..(((.....|||..,,..}}))},,..},..))))))))).....((((((((......)).)))))).{({{.((((((((((((((..((((((,{((((.((((.((.....)).)))).)))))))))..((((((({((((({((......,..}}}))..)))))}.,}}}}}}.((.((((.((((...({{((({.{{{{..{{....,,(((((..(((.......)))..}}))},,,....{{{.....}}}..((((.((((.(((((((((((((((((((((((((((..({.((((.{(((((((((((((((((.(((((((((.((((((((.(((((((.((((((((((((((((((((((((((((((((((((((((((((((((((..((((((((((.((((((((((..((((((((((.((((..,,.((((((((((((((..(((((((((((((((((((((.,.(((((.(((((.(((((((((.(((((((((((((..(((.((((((((..((((({{(((((({..(((((((..{((((((((((((((....(((((((((((......)))))))))))....})))))}..(((((,{,{,.{..,,((((((....}))))).))},}..}),)),,}}))...,)))))))},,,,...,{{{({{{|,{,,((,(((((((,{({{{(,{(({,{{,,.....}},,{{||.||.{{{{{,,,,,))))}.,,)),}}}}..,}}}}.|||||||,||.|,}|||,}}...})))))})).},,}}|||,,(((((......))))).}..}}})))))))....},)))))))))))).)))))))).)))..)))))))}}))))).))))))))).))))).))))).,.)))))))))))))))))))))..)))))))))))))).},))))...))))))))))..)))))))))).))))))))))..))))))))))))))))))))))))))))))))))))))))))))))))))(({...})).))))))).)))))))).))))))))).)))))))))))))))))}.)))).}).))))}.,...,{{{..,,))}})))))))))))))))))))))).))))..))))....})..}))).,,,)}}))}...)))).)))).))..{{{{............{(((((((((((.((......)).)))))))))...))|((((((.(((((((.,...((((((((,{..{((.{(,,,.|}}}}.....||{......)}}||,,,,)}.(((((((......)))))))(((((....)))))....))))))))....,))))))))))))),,(((....))).,}}}}(((((({{{........{{.......)).,.....}}}.))))))....))..))))))))))))))..))},..(((((((..((((.(((((.((..(((((((.(.((((((.(((((.({....)))).))).)))..))).)...))))))).))))))).)),))..)))))))....))))).).))))))))))(((....)))((((....))))..................,.,.,}}))}),,)))..)))})))))}...)))))).))))))))))))))).)).))))}},.))).))))))).,.))}.}))),,))))))))))))}))))...))))))))))},))))).))......,{{{........}|||((((,{.(((((....((((((((((((..((({....}.)))..))))))))..{|{{{{((,{((((....}||}.||,||}}||}}.{{.((((({(({.(((((((..((((((((((((......((({.,,..,||{(,,,,.,,,}}||||}}}}.{|||}.||||||||{,{(({(((,,({{,..,,||||{{.|||||{,,,((((|{({,,{((((,....(({..{{{(((((((......))))))),}}}.,,.,,,|,,..........,,.,..{(((((......)))))),,|||.,....,.|||{||,...{||{,||({.(((((......))))).))),,,,,,,{{{((({,{({,((((((.({...(((((.(((({((((......)))}...((((..(((((...(((.(((((.((((.(((...))).)))).})))))))...)))))..)))),.....}))).)))))..})))))))))).{{{{{...|}}}|,,})))))}....)))}.}.))))))...(((((((....(((((((...((((....((,{(..((((((((,,,,,.......((((....))))..,((({{{{|||.,.|.{{{({((({..{{|,,.,,,},)}),,),)))}}}.,||,}}.}},.))))))))..))))....)))))))))))))))))),)}))))))))))}},),,)))}...))))))))))}),....))))))).....|||}|{..|||{|,,,,..||,...}||,..........|{.|||{{{..,,)))})).)),..........((((......))))..{(((..(((((({,..........,{(((((((((((......(({....})}...)))))))).))))))))))..)))).(({{{{{{{{.{({{{|{...{{{,({((((({{....{((((({....,(({..,{,,((.,,.,(({{,,{{{((..(((..(((,(({(((((((..(......)..))))))).))).)))..)))...,,))))),.)})})....))}..}}..)))))))))}....)).))))}.,)))))..,....((({.{,|||{.}},}}))}}}|.,.}})},...((((((((((((({((((({.(((....(({....})).)))}},)))).((((...)))))))))))))))))),.(({((({{...))}))}})))|,,,..})))))))))...))))}}}})})).((((((((........))))))))....)))))))))...))))}||{{....))}|((.,{{{{....(((((,...{(((((......)))))))))))}))))))(((((...)))))...))))).))))),)))))))),,,,..((((((({..,(((((((..(({(.(((({.{{.((({,((((((....)))))).,{{(({((({,,.,{((((({({{..........,{(({{((.{{,,||{|||,||..||,,,||,{,,....})},,,........((((((....)))))),,||||{{{{,...,.,|...}))}))))}.,,))}))}|||.((.,||}}||}}}||||||...|}}},...,,,,}}||,|...,|.}}}}},}}}}}.))))...{{{{..,|((.{(((((....{{|||||..,,),))))||{{(((....((((......)))),},.)))}.)))))}))}.}}||.(((((((..((.{....}.))...)))))))|||,{({|||..,,.,((((..{,.....,...)))).,,,,(((({......,,,..,{{.....}}}..((((((((((((.,((((,(,...,),)))).,))))))))))))..}}}}}}},,,)})))},}})),))})}..,........,.......))))))))))))))).....

Transcripts

ID Sequence Length GC content
GGUUUCCAGCCAUGGCUGCCAUUACCUGACCAGCGCCACAGCCGGUCUC… 6813 nt 0.4930
Summary

The protein encoded by this gene is found on the surface of platelets, monocytes, neutrophils, and some types of T-cells, and makes up a large portion of endothelial cell intercellular junctions. The encoded protein is a member of the immunoglobulin superfamily and is likely involved in leukocyte migration, angiogenesis, and integrin activation. [provided by RefSeq, May 2010]

Forensic Context

A study in humans demonstrated that PECAM1 is a pan-endothelial cell marker expressed in all populations of endothelial cells within the corpus cavernosum of patients with severe erectile dysfunction, and its expression was specifically high in a fibroblast subcluster co-expressing endothelial markers [Fang et al. DOI:10.3389/fendo.2022.874915]. Another human study of ischemic cardiomyopathy validated PECAM1 as a global endothelial cell marker, using it in co-staining with MYO1B via in situ hybridization to confirm the presence of angiogenic endothelial cells in cardiac capillaries [Simonson et al. DOI:10.1016/j.celrep.2023.112086]. A study in mice demonstrated that the PECAM1 is used as an endothelial cell marker for immunofluorescence staining to identify type H vessels (CD31+/Emcn+) during angiogenesis in the fracture callus, where its presence, alongside Endomucin, indicated enhanced neovascularization promoted by hypoxic mesenchymal stem cell-derived exosomes [Liu et al. DOI:10.1016/j.actbio.2019.12.020]. In a separate study using rat cardiac fibroblasts, the PECAM1 was employed as a negative marker for cell type identification, confirming that cultured fibroblasts were negative for this endothelial cell marker [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].