| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGACGGCGAGGCAGGCGCUCAGAGCCCCGCAGCCUGGCCCGUGACCCC… | 1251 nt | 0.5060 |
This gene encodes a preproprotein that is proteolytically processed to generate multiple protein products. These products include the pentapeptide opioids Met-enkephalin and Leu-enkephalin, which are stored in synaptic vesicles, then released into the synapse where they bind to mu- and delta-opioid receptors to modulate the perception of pain. Other non-opioid cleavage products may function in distinct biological activities. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that the PENK is a striatal marker enriched in the nucleus accumbens of unaffected comparison subjects [Seney et al. DOI:10.1016/j.biopsych.2021.06.007]. In mice selectively bred for differential methamphetamine consumption risk, the PENK was identified as a differentially wired gene in the prefrontal cortex, indicating its involvement in synaptic and transcriptional networks associated with addiction vulnerability [Hitzemann et al. DOI:10.3390/brainsci9070155].