Basic Information

Symbol
PER1
RNA class
mRNA
Alias
Period Circadian Regulator 1 RIGUI PER Period Circadian Protein Homolog 1 Circadian Clock Protein PERIOD 1 Period Circadian Clock 1 HPER1 Circadian Pacemaker Protein RIGUI Circadian Pacemaker Protein Rigui Period, Drosophila, Homolog Of Period (Drosophila) Homolog 1 Period Homolog 1 (Drosophila) Period Homolog 1 KIAA0482 HPER
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002616.3
Sequence length
4676.0 nt
GC content
0.6268

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2004.40 kcal/mol
Thermodynamic ensemble
Free energy: -2078.94 kcal/mol
Frequency: 0.0000
Diversity: 1480.09
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(..(((..((((.((((((((((((.(((((((((.((..((((((.((((....)))))))).))((((..((((((.((((.....((((........))))....))))................)))))).))))..(((((.((.((......)).)).)))))..........(((((((((..........(((((((.((((((.(((..(((....((((((...((((((.((((((((...((.(((.((.....)).))).))))).))))).)))))).))))))..((((((.(((..(((((((((....))))))....(((.((((.(((.....))).))))))).((((.((((........((((.(((((((...(.((..(((.((.((((((.....))))))..)).)))...)).)..))))))))))).(((((..(((.(((((((..((....)).....))))))).(((((((((........((((((...((((..(((((.(((((.(((.(((...))).((((.....)))).((((((((((((((.(((..((((((((..((((.....(((.((((...............))))))).))))..)))..)))))..(((((.(..(((((((.......)))))))..).))))))))))))))))...))))))((((((((...(((((((((((......(((.........(((((((((((((((((((((((.(((.((...)).)).).))))).((((((.(((((.(((((((((((((......(((((((....)).)))))((..(((.....)))..))((((((((.((((..(((((......)))))........)))).))))))))((((((((((...)).)))))))))))))))(((...)))((((....))))....))))))))))).))))))..))))))).)))))))))))))).....))))))..))))).)))))))))))))))).))))).))))....)))))).....(((((.....((.(((((((......))))))))))))))...)))))...))))...))).)))))))))))))....((((((.((.((((........)))).)).)))))).....)))..))))))))).((((.....)))).(((..((((...(((((((((((((.(((((......((((..(((((............(((((.........)))))))))).))))....((.(.((((((((((((((((((.((((.....))))(((((.(..(((((...))))).).)))))..((.(((...(((((.......)))))))).)).........(((....)))))))..)).))).))))))))).)))(((((((.....((......)).......))))))).((((......))))....)))))..))))))))).)))).))))..))).)))..)))))))))))))))).......(((..(((((.(((........).)).)))))..))).....(((.....)))(((((((.....((((........))))))))))).)))))))))....)).))))))))).)))))))....))))).....((((.(((...((((((((..((.(((.((.......))))))).)))))))))))))))......))))..)))..)(((((((..((.(((((((((((((((((((((((((.(((..(((((((.((((....)))).)))....((((...))))(((((((((((.........(((...((((.((((........)))).)))).))).)))))...(((.(......))))..))))))...((((((((((((..(((((((((....(((((((((((((...((((((((............(((.(((((((((((.(.((((.......))))).)))(((....(((((((.....))).))))..))).)))))))).))).(((((((((....((((((.(((.........((((((((((.((((((((((((.((((((..((((.(((...(((.......((((..(((.(((((((.....(((((((((.(......).))).))).)))..((((((.((((((.(((.(((((((..((....(.(((((.((((((.(((.......)))..)))))))))))).......))..).).))))).))).)).)))).)))))).(((((..((((..(((.....)))..))))....)))))..(((....))).(((((...)))))..)))))))))).))))((((...(((((.(((....(((...((.(((((((.((((((...(((....((((((((((((.....))))...))))))))....)))...))))))..(((......)))..((((((((......(((.(((((...((((.....))))..)))))...))).......))))))))....(((((((.((.(((((...(((.(((((......))))).)))....)))))..))....(((((((((.......(((.....)))...((((((.((((....)).))((((....((((((((.((((((.(((((.((..(((((.....((((((((((((.(((((.((((((((((.(((......(((.(((((((....(((((.((....(((((.((((((.((..((((((((.....))))))))....((((....((((((.(.((((((..((((.(((((((((.((((.....))))((((((..((((.((.............))..))))..))).))).....(((((((((((.((((((((((.((..((((((...........(((...)))...))))))..)).........((((..(((..((((((........(((((...((((.............))))...(((((....((((((((((......)).)))))))))))))...((((((((.(((((.(((....)))((.(((((.((.(....).))))))).)).)))))))))))))(((((((.(((((....((((...))))(.(((((((((.(((((......)))))((........))..))))))))).).(((.(((((......)))))..))).((....))...))))).)))))))))))).....)))))).)))..))))...))))))))...)))).)))))).)))(((((((.((.((((((((.....(((..((.(((((((..((.......)).....))))))).))..)))(((....))))))..)))))))))))))))))))))))..)))))))))).)))))))....))))...(((((..(((((...((((((......))))))((((...((((((((((((...((((...)))).(((....))).))))))....)))))).))))))))).)))))((((...)))).(((....)))((..((((((....))))))....)))).)))))).((((((...)))))))))))...)).))))))))))))...)))........))).))).))).))))...)))))..)))...(((...(((.(((((......)))))..((((....))))..))))))...)))).)))))..)))))..)))))))))))))))))))))..)))))))))))))))))))))))))).)))))).).)).)))....))).)))))..))))))).)))...))))..))).)))))))))))))))..(((((.(((.((.....))))).))))).......((((....))))........((((((....((((......))))))))))...((((((....))))))....((((((((((((((...((((((..((((..........((((((....((....))...))))))....(((((.....))))).....((((((..(.(((((((((((((((((.(((....)))..))))).)))).(((((.(.((...))...).)))))....(((((((....))).))))...........)))))))))..))..))))...(((((..(((((((.....)))).)))))))).))))...))))))...)))))))))))))).))))..))))))))))))))).))))))))).......((((((((.....)))))))).))))).)))...))))))))))((((((....)))))).)))))))))).))..))).)))))))))....))))))).)))))))........))).))).))))))).))))).))..)))))))((((...))))...(((((((((...(((((((.................)))))))....))))))))).
Thermodynamic Ensemble Prediction
...(({{(((((((....)))).)))))|{((((,(((.,{({(,((.((({{{.|{||{||....{((((,.(((((.((({.....((((........))))....},||{(((.((((.((((.,.((((((((((..,(((,..,.,({((..{{{{((((({,|({(({((((((.(({,{({{.,((({{{,((((,{|.,.{|,|,((((((......||||||..,(((({,.{{{{|||||||||||||||......,,,,}}|||||{.,}|||.,}}}})})))))),{(((((,{(((((((.,(((((....)))))|{{{.(((.((((.(((.....))).)))))))..}|||..(((((((..,((((.(((((((.{{({{(,.,,,.,|,((((((.....)))))).,)),)))}..,||}..))))))))))}((((((.,....(((((((..((....)).....))))))).,...........)))))){{{,{(((({,,.(((((.,((((((....)))))).,..((((.....))))....|.))))).}))))))}}}.{{{|||,.||||..||}||||,..((..(((.((.(.(({..(((({{((....))))))).))).},|||}|..||(((((..{{{{.|||||||(,,.{,(((({.{.(((.....)))})))||{{{|||...{{(({((((((......((,........{(((((((((((((((({(((({{..||}}})})},{(({....)))}((((((.(((((.(((((((((((.,......(((((({....})}})))).,..(({..,..,,,..,.((((((((.{{{(..(({({.,....}})))........)))).))))))))((((((((((...)),})))))))},}},,{(((...)))},,,,.,}),))))).))))))))))).))))))..}}}}))}.))))))))))))}}.....)))))).,}||||{|||,|||(((({,,,{(((({,{{((({{,,.(((((((.{....|.))))))).|{(((((......)))))||(((((({...,,,.,,}}))))))|((({{{{,,|.{{{{{{{{..((((((.((.((((........)))).)).))))))...{{({((,{{.||||.{{((((.....)))).))}||{(({(,{{({{.,||,.{{{{{{{||,...,,(((....|||))...........((((({,,.....,||,||.,....,,||{.((((.(.((((((((((((((({((,((((.....}|||((((,...}|||||}}})))}},},}}}}}..{{.{{{...(((((.......)))))}}},||....|,,..{({....}))))))..)).)))}})))))))).}))))|||,......||,.,}))))}})}..}))))))).||||,,,,,|)},,..((((((((((({{{{{{((,({...||.|||}}}}))}..}}...}})}.((((((......(((..(((((.{({........).)).)))))..)))....))))))))))))))))).....((((((........)))))).)||}}}}},||||.||,,,.((((((....)))))).}|((((((.(((........)))...))))))|(,,(({((.{.({....{{{{||||{{({,{{||,({(({,||,,|,..,,},..}}..)||||,|}.}|,}}}||||}}|}||,,|}}.|}|||.,.|}||.,,{.(((.((((....)))).)))..{{((({,.|)}||||((({{(,.((((......}}}}..,((({||(({,...,..,.))))}.(((((((.(((((.(((.(......))))..(((((((((.......(((((((((...{.(((((.(((((((({{{,,.......,||{.......|,{(((((((((((((((({.(.((((.....((((((((((((((......)))))......{((((((........,,)))))).)))))).)))....}))}....((,.......}}......},))}))})),,,,,,........,,{((((.((((.{,........}))).))))},,)),,|||...}})}))))}))}})..,)))))))).)))))..}...)))))))))((((....))))..)))))).))).))))))))))))....,}})},,||||}}|}})|||....})))))}),),,))))),}}},|||},,...}}}..(((((.,((((.{(((.....))).})))).,..)))))..{{{,.,.))).(((({...})))),,))})))}}}})}},}.)}}}})))})}})}})))})}.,.)))),,.))}}),{{{..,,,,)))...((((((((((((.....))))...))))))))..))))))))))))))..,,|.,.,,,})),}||{||||{.{{{{{({(,(,((((({,{{{,,..,||||..|||||,{.|||...|...}}})}))),,,}||{{||||||,|||||,}}|||,|||||}}}}}}))),,.,))}}......)}}.((..((((((((((.......(((.....)))...((((((.(({(....,}.)){({{..,,((((((((.((((((.((((((((..(((((.....{{{{{.,,,,{({,,,,..,,..(((((.{(.........,.}|.|||}}{((((((((,.,,..,,((((.({((({.{{..((((((((.....))))))))...{((((....((((((.(.((((((..((((.(((((((((..,(((,.{{|||,{({((({.,{((,((,,,...,,.....))..,}},..}}}.,,,|,,..(((((((((((.{{((((((((,((,,{{((((,,.........{((..,|||..,||||||..||.....{,,,(({,..({{,.((((((........,,,,||}|||......,,,,.....}}},.|,{(((({{,,(({(((({{{....,,)).))}))))))})}},..,{|||{{|,|||||.|||.,..)))}|}|||||}{{.|},,},.}}|||||{||,|}}||||}}}|}|(((((((.(((((....(((,...})))(.(((((((((.(((((......)))))((.......,))..))))))))).}.{{{.(((((......)))))..))}.||,,.,)).,.))))).))))))))}})),,...))))...))}..)))),,.))))))))...,,)).)))))}}}))}}}||||,{(,(((((|{|,....{{(..((.((({(((,,((,......|}.....))))))).))..}}},,,...,))))))}.})))))))})))),)))))))))..)))))))))).)))))))....,}},...(((((..(((((...((((((......))))))((((...((((((((((((...{(((...}))).(((....))).))))))....)))))).))))))))).)))))((({...}))).(((....))}||.,((((((....))))))....)})).))))}}{((((((((....{((((,((((((.,.((((((.|,((.(({|....,})).))).)))))).,.)))))).,)))))))))))))},|.....(((((......)))))..{|{|....))}))))),.))..)))))})))))..)))))..))))))))))))))))))))).,)))))))))))))))))))).,)).|||||||}.|{||.|((({..,,,,)))))..||||,..)))))))))).)))))))}.)))))))).)))))),||{.{{{,....))).))))}))).)}}}}...))}))}..,,|{{{{{{...(((((({{,(((((......})))))}|||{{,{((((({{.{||||||,...((((((((((((((,..((((((..((((..........((((((..,,({..,,)},,.))))))....(((((.....))))).....((((,{..{.(((((((((((((((((.{(({...})).,))))).)))}.,(((({(.{{...}},,.|.||||}....(((((({....})).)}||......,,,,,))))))))}..|}|.)}))...{{{{(,.{{{{(((.....)))}.})}))))),))))...)))))).)})))))))))))))),||{.........)))))))))}.}))}})|||||||{,((((((((.....)))))))).|||,,,)))(({(((((.....((((((....))))))..))))).))).)))))))))},}})))))}.,))))))),)))))}),{{({{...,},))},,.,,}).)))))).))))),))).)))))}..{{{.{{{((,((((((.({((,,,,,..{{....}}......}))))))))).))))).,,)))

Transcripts

ID Sequence Length GC content
GGAGCUUCCACUCGGCUGCGGGCUGGAGCGGCGGCGGGCAGGCGUGCGG… 4676 nt 0.6268
Summary

This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene may increase the risk of getting certain cancers. Alternative splicing has been observed in this gene; however, these variants have not been fully described. [provided by RefSeq, Jan 2014]

Forensic Context

A study in humans demonstrated that the PER1 exhibits statistically significant rhythmic expression in blood, with peak expression occurring between 08:00 h and 10:00 h [Lech et al. DOI:10.1016/J.Fsigen.2015.12.008].