Basic Information

Symbol
PER2
RNA class
mRNA
Alias
Period Circadian Regulator 2 KIAA0347 Period Circadian Protein Homolog 2 Circadian Clock Protein PERIOD 2 Period Circadian Clock 2 HPER2 Period (Drosophila) Homolog 2 Period Homolog 2 (Drosophila) Period Circadian Protein 2 Period Homolog 2 Period 2 FASPS1 FASPS
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Cause of death analysis Postmortem interval inference

MANE select

Transcript ID
NM_022817.3
Sequence length
6380.0 nt
GC content
0.5245

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2241.40 kcal/mol
Thermodynamic ensemble
Free energy: -2351.63 kcal/mol
Frequency: 0.0000
Diversity: 1744.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((....((((((((..(((((((((.....)))))))))..)))))))).(((((.(((((((.((((..(((.((((..(((((((((((((((.(((((((........(((((((((..(((.(.((((((((((((((((...((.((((.((((....(((((((((...))))))(((((...((((((((.((...(((((((((((.(((((((....((((((.(.(((((....))))).).)).))))...))))..))))))........(((....(((((...)))))))).(((((((..((((.........((..(((((((.(.((.((((((.(((((......))..))).))).).)).)).).)))))))..)).................(((((((..((((......))))..))))))).(((((....))))))))..)..)))))))...(((((((.((........))))))))).((.(((((...(((.(((.......))))))))))).)).)))))).)).....)).))))))))))))).(((.((((...((((.........................))))...)))))))..)))))))))))))...))).))..)))))))))))).)))..)))))))))(((((.(...(((((((...)).)))))...)))))).)))))...)).))))....)))))(((((..((...((.((((((..((((.((..((((..(((((.(((((....((((((((((((((.(..((((((..((((((.((((.(.......))))).)))))).))))))..).))).((((((.((((...........(((((.(((((((((.((((((.(((......)))...).)))))...(((.(((.(((......))).))).)))(((((.(((...))))))))(((((((.((.....((((....(((((.....))))))))).....)).)))))))..((((((......))))))(((((((((((((....))))))).))))))..((((((((((.(((...((........)).)))........)))))...)))))...))))))))))))))(((.(((.....))).)))(((((..(((((.(((((.......)))))..)))))..)))))((((....))))...(((((((((.......)).)))))))........)))).)))))).....(((((((((((..((.(((((((((((.((((...(((((((........)))))))((((((((.......(((((....))).)).(((....))).((((..(((..((.(((....)))))..)))..)))))))))))).)))).))))).....((((((((..(((((........)))))..))))))))......(((((((........))))))))))))).)))).)))))))))...)))))))))))...)))))))))).......((((((((((((.....))))...........)))))))))))).)).))).)..))))))))))..)))))......))))))..))))...)))..)))).))).)))).)))))...(((..(((.((....)).)))..))).((((((....((..(((((......).))))..))..))))))(((((((.(((..(((..((....))..).))..))).))))))).......((((.((....((((......))))....)).))))....((((....))))..(((...............)))))))).......(((((.((((.....((((.(((((((((((((((((((........)).)))..((.(((((((((((.....))))))))))).)).....((((....(((((......)))))....))))...))))))(((((.((((.((((.(((((((.....(((((((((..(((....)))....((((((.........((.(((........(((((((((.....((.((.((((((((((((..(((((((.(((.((((((.(((......))))))))).)))....((((..((((..(((((....)))))..)))).)))).(((((......))))).(((((......)))))....(((((.((((((((.((((((((((((((..(((((...........)))))............))))))))....))))))..)))).((((.....)))).))))))))).)))))))..)))).)))))))))).)).....(((((...))))).....)))))))))......))).)))))))).((((((((((..((((((.(((((((((((.....)))))))..........(((((.......)))))((((...))))..........((((((((..(((((.((((((((.............))))))))(((............))).....(((((((((((.(.((((((((((((((.(((((....((.(((((((((..((((...(((.(((....))))))(((...((..(((((((((....)))).)))))..)).))).(((((((((.....(((((((((((..((((.(((((((...((((..((((((...(((..((........))....).))..)))))).....))))..)))))))........))))((((.((((((..(((.(((((.((((((..(((((((((((((((((((((((((((.(((...((((.....(((((((((((.(((((.((......(((.(.((.((((.(((((..(((((....)))))..(((........((((....))))........)))((((((((.....(((...((((.((((((..................(((......)))..((((.(((((.((..(((((((.(((......))).)))).......((((((.....)).))))..(((.....)))............)))..)))))))))))........(((((((((((...(((((((((.((....)))))......)))))).)))))))).)))..)))))).))))...)))))).)))))...))))).)))).)).).))).....)).))))))))))))))))))))...))).)))).)..)))))...)))))).(((...(((.(((....(((((..(.(((((......(.(((((((((.....((((((.((.(((..(((((((((((..(((((((.(((((((.((((((.((.((.(((((((.((.(((((((((....)))).((((((((.((.((((((((....)))).))))....(((((....)))))(((.((....((((((((((.......(((((((.((.....(((.......(((((..((((............))))..)))))......)))..))))).))))(((((((((.(.......).)))))).)))((((.((((((...))))))....)))).))).)))))))......)))))((((.(((((..(((.......)))...))))).))))...))))))))))......))))).)).))))))).))..)).))))))((((..((.(((((.(.(((((.....)))))).).)))).)))))).............((((((...(((((.....((((.........))))....((((((....))))))....((((.(((......((((.............))))....))).)))))))))..)))))).......))))))).)).............)))))...)))))).....))))).....))).))))))))(((((.........))))).....(((.((((......)))).)))...(((.((((((.(((((((........))))))).))))))))).....))))))))).)......)))))..)..)))))...))))))..))).(((((((((.......))))))))).))))))))....)))..))))))((((..(((((((....((......))....)))))))...))))..))))).)))..)))))).))))((.....((((((((((((((((((((((...(((((((((.(((((..(((((((((((((...))))))..)))))))))))).....((((((.(((....((((((....))))))....))).)))))).......(((((((.(((..(((((((((......(((((((...(((((........)))))..............(((((((((((((....)))))))))))))..((((....)))).(((....)))..)))))))((((...........)))).....((((((((.....))))))))..)))))))))..))).))))))).(((((....)))))(((((......(((...)))......))))))))))))))..)))((((......)))).((((...((((((......(.(((...))))......))))))...)))).)))).)))))))........)).)))))).....))..)))))))))))..........(((.((..(((...(((((((.....((((...))))....))))))).)))..))))).....)))))))))............(((.(((.((((...))))..))).))))))).))))).)))).))))))).))))).(((((((((((.............)))))))))))((((((......))))))((((.......))))((((((......)))).))......(((((.((((((((...(((((((((((.(((((...(((((.(((((((...(((((((((((((((.(((((........((((((..((((.(((((...((..((((((......((((((((.....((((((((((((...((((..((((((..((((.....))))))))))..))))..)))(((.((....)))))...)))))))))))))))))...............................((((..((.(((.(((.((((.((((((((((((.((((...))))))))))))..))))))))....)))..))).))..))))...(((((....)))))((((((((......(((....)))......))))))))..)))))).))...)))).).))))))))))......))))).))))))))))))).....))..))))))).).))))........)))))...)))))))))))......((((((......))))))..)))))...)))))))).)))))))))..).)))))).)))))((((((((.....((((((((((.(((((.......)))))..))).....)))))))(((((.........)))))....(((((.....))))).))))))))....(((((..((.((((...((((((((((((((...))).......(((((.(((((((.....(((.(((..((.((....(((.....)))))))..))).)))))))))))))))(((((.((((.....))))...)))))..............(((((..(((.........)))))))).)))))))))))....)))).))...))))).(((((((((.((..........))...)))))))))......))))).))))))))........((.((((((...)))))).))..)))))))))).)))))))))).......)))......((((((...........)))))))))))).......(((((((........))))))).....))))))).)))).)))))))))(((((((.(((...))).)))))))(((((((......)))))))...))))))))...))))......)))).)))))..((((((((((.......))).((((((((..((....))..))))))))..)))))))........
Thermodynamic Ensemble Prediction
.{{{,,,{..((((((((..(((((((((.....)))))))))..)))))))).||(((.(((....))).))}(((,(({,..(.(((.(((((((((.(((((((........(((((((((..(((.(.((((((((((({((((.((((.(((({,(((((((({,((((,,...))))))})|{{...((((((((.((...(((((((((((.......,})},((((((.{,((({(,,,,}}|||,|.}},,,)),}}))))}.))))||,,|.....|||....(((((...))))),||.(((((((..((((,{......((((.(((((,({(.((((.{(((.(((((,,,...}}..)}),})),).,|{||{|{}}}||,..{{{.,....,.))}......|||)}))..|,))})}}}.)))},,))))..,.{((((....))))))))..)..))))))).}}(((((((.((........))))))))).((.(((({...{({.(((.......))),}}))))).}}.}))))).)).....)).)))))))),,})))||,}||||,...(((,,,...,.,......,|,.......,,,,...}}|,})}..,)))))),}}))))..)))}.}..)))))))))))).)))..)))))))))(((({,(...(((((((...)).)))))...)))))).)))))...)).))))....))))).))).}{(((((((((((.(({,,(((((({{(((,({({({(((((........))))),{{{((((((((({(({,.((((((((({{(((((({,({|(|{...||||.|||((((,((((..((((((.((((....{(((((((.,((.(((((((((.(((((,.,,{......},}...}.)))))...,{({{({.,{{..,{(((((,,||,|.|(((((.(((...)))))))}{||||||}|...,..((((,.(((((.(((((......))))).))))).),)))),..((((((......))))))(((((((((((({....))))))).)))))}..{{|{|{||{{.,,|,,,|||...,..,)}.)))........}}}}},..}}}))...))))))))))))))))))|{(....,|||.{{{(((((,.{((((.(((((.......)))))..)))))..)))))((({....}}}}...{(((((({({,,....})}))))))}.....,..}})).}})))}....,{{{{{{{{({{..{{||{|{..,((({{({({,..{{{{|||........)))))})||||||||....}}}}|{((....))).,},}}}}}}.).))))))),{{{|||||{||}}|,}}|}}},..||||||}}{(((((((((((.((...{{((.,,,,,,,,..,||||....}})}))|||{{||||||,,..{({{(((((((........))))))){(((({{{{(((||{||.{(({.....)))).).))..)))).|||.....|||,((((((((((((.....))))..,,....,,.))))))))})),,}{(((.(((((((((((...(((((....{{((((((,...((,,...))....)))})))|,((|.(((((,,.{{,..{|{,||,...)).|||..|||,|{{{||}|.,||.,{(((,,,..{,|.,|||,,||.|||}|},{||||,,.||{,.,||...||||,|||||.}},..,,{|||||||((((({,.((((((({..((((......))))...,,,...((((((((..((.((({...(((({,({..{({,.......,,,.{{,,{{||,.,,,....(((((((,,....,,...(((((((.{...........))))))))))))))...{{{{{.((((((((((((((.(((.{((((({{....,,||{.,...(((({{{.,{{,,|{{{|,.||,,((((.((((.((((((.((((.,,..((((((.((..(((((,...{,....((((((.,{,,,,..,{.{{{..{,{,,.{((((({({.....((.(.{((((((((((((..(((((((.(((.((((((.(((......))))))))).)))....((((..((((.{(((((....))))}.})))).)))).(((((......))))).(((((......)))))....(((((.((((((((.((((((((((((((,.(((((...........)))))............))))))))....))))))..)))).((((.....)))).))))))))).)))))))..)))),}))))))))}.)).....(((((...))))).....))))))}}|,.....}))})})))))).,,.,.,,{((...((((((.((.(((((((.....))))))).....,,,..,,,..,|,....{(((((.(((((((,|,.{,.....,.,,,,....{(.(((,{(((((((.............)))))))))))}}.........{((((({.{((((((.,((((........))))......((((....((,,(((,..{,(({,....}),}..)))))})))).,......))))))}(((((((.(.....,,..)))))))(((((.(((((.....(((((((((((((.......(((((((...((((..((((((...((,,.((........))....},)}..)))))).....))))..)))))))...}.))))))..)))))))))).)).))))).,((((((((.....((((((((((.((((((.,((((.(((...((((.....(((((((((((.(((((.((......((({,.((.((((.(((((..(((({....})))}..(((........((((....))))........}}}((((((((.....(((...((((.((((((.....({(,,,.......(((......))).,((({.{{({|.|,..{{,{(((.(((......))).)))}.......((((((.....))}})))..,,,{{{{((({{...........)))}.))))),|||},..,,....(((((((((((...(((((((((.((....)))))......}))))).))))))))}}))..)))))).))))...)))))).)))))...))))).)))).)).).,,)}}}..)).))))))))))))))))))))...))).)))).,)))))),,..{|||{{{(((,....(({.{{{....)))..}}|.,...,,{|||,((({{((((,,{{{({{({((((.{{{..{{((((({{{{..{{|||{{.((((({{.((((((.((.((.(((((((.((.(((((((((....)))}.((((((((.({.((((((((....)))).)))).||.{{(((....}}|||{(({(,...,(((((({,,{,,,{{,{((....}}}.....}}......,.,,},}}....||||||||,.....,|||,(((({{....,})))){||{||{.,|,{{{(((({{,(,,,,,.,}||}}}}),})}),)))||{{||...))}))),}}})||||||||,,},,,,...,,,)))}|((((.(((((..(((.......)))...))))).)))),..)))))))))).....}))))).)).))))))).))..)).)))))){{,{..{{,({(({.{.(((((,...,)))))}.)}}})},)))))).}},..}}},,,,||||{{...((({(,,,,,(((({{,,..,{{||||....((((((....)))))).,,,(({(,((,.....,|{||,,,..,,...,..}}},....}}|,||}}}}}}}..}}}}})},,,...}}||||}.}}.....}}},..,,||||,.,,,|||}},,,,|}}))).....))),))))))})|{{((,.{......))))).,|||(((.((({......)))).)))},,}|,.||||||,|||||||.,,,,,,,||}}}}}.}}}}}},}),}}}}))))))))).}},...))))))))).)))))))).})))))}}.,..{{{{{{(((,,,,,,,|}}}}})))}}))))}},...))))))),}))))}|}..,{{{({{.,,.|||..,,,}}..,.)}}}}})).)))))).}))))))))..)).))))))},))))))}..))))))))))),,}|,||||.|.,}||||}||||((((..(((((((((((((...))))))..))))))))))),..,{.((((((.(((....((((((....))))))....))).)))))).,,..,.,{{{{{{.,((((,,((((,,,...,,,|,||||,...(((((........)))))..,,,.........(((((((((((({....})))))))))))},,{(((,..,|||},(((....)))..))))}}}|||||.....,,,,.}))),.,,||{{|||{{,....}})}}}}},.}}}))})))}}}}}.}))}}}}}}}}||...}))))).))})))))))))).))))..}}},||,...||||(((({...))))}.....,}))),,}.}}}))))))))..})))}}..}}}}))))...,,||{|{{{......,.))),})||||{{{.......))))))),,..)))))))}.{((((((.{.,..{{....)),.}.}.))).))))})))))))))))))},{||,.....)))},.,.}}|||}.|||{{{{{{..,,,.............,,{{{.(((.((((...))))..}}}.|||{|({((,,(((....))).}}}}.....|||((((((((((.{...........))))))))))}||||||}}}}..,))),|((((.......)))){(((((......)))).))})))))}})}}..}))},|||,.(((((((((((.(((((...(((((.(((((((...(((((((((((((((.(((((........((((({..((((.,{{{{.,.,..,{({{{{,,,...((((((((,....{(((((((((((...((((..((((((..((((.....))))))))))..))))..))){((.((....)}))}...)))))))))))))))))...........................,,,.((((..((.(({.(((.((((.((((((((((((.((({...})))))))))))..))))))))....)))..))).))..))))...(((((....)))))((((((((......(((....)))......))))))))..,,}}}},},...,}}}.}.))))))))))......))))).))))))))))))}.,}}..}..))))))).).))))........)))))...)))))))))))...,,.((((((......))))))...)))))..))))))))))).)))))))}))))}))))...)))))))}..}))....((((((......}))))).......)))))))}.....,..,}|||||||||,....,|{{,.,,,{,,,,.....{|,,..,.,,.,}||||,,,({(((((,,.({{{{......)))))))}}.}}},,,.....||(((.(((((((..,,.{{{.(((..((,{{....{{{.....)))))))..))),))))))))))))}},(((((.((({.....}}}),,.)))))..............|{{||,,|||},.,.....,|,}||||,.,,.,,,.....,}}.}}))))),,.,|,..(((((((((.((..........))...)))))))))....||||}}}.},}}}}||,....,},||.{|||||,..)))))),),.,}}}}))))}}.}}}}))}))))}.}}}))),}.....((({({...........}}}}}}||,.,|,{{{{{.{((({({......},))))))).||.||}}||}|{|||..})))})},}}}||}|})).))))))))))))..((((((((......)))))))},})))}}.,,...{{{|,{((.....}}))}}}}}||{{{{{(((.......))).((((((((..{{....}}..))))))))..))}})},........

Transcripts

ID Sequence Length GC content
CGUAACCGCCGCCGGCGCGCGGGCCUCGGGCAGGUCGGGGUCCCAGCGC… 6380 nt 0.5245
Summary

This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]

Forensic Context

A study in humans developed a targeted RNA sequencing protocol for predicting the time-of-day of bloodstain deposition, where the PER2 was included as a candidate from previous publications and its coefficient in the final penalized regression model was 0.000 for both sine and cosine components [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287]. Another study in humans identified the PER2 as a circadian rhythm-related gene mentioned as a potential marker of sepsis severity, though this specific application was not experimentally studied in that paper [Wang et al. DOI:10.3390/ijms26093993]. A study in mice demonstrated that circadian oscillations of mPer2 and mBmal1 gene expression and their ratio could be detected in kidney, liver, and heart tissues for at least 48 hours postmortem [Kimura et al. DOI:10.1007/s00414-010-0527-4].