Basic Information

Symbol
PEX19
RNA class
mRNA
Alias
Peroxisomal Biogenesis Factor 19 HK33 Peroxisomal Farnesylated Protein D1S2223E PXMP1 PMP1 PMPI PXF 33 KDa Housekeeping Protein Housekeeping Gene, 33kD Peroxin-19 PBD12A
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002857.4
Sequence length
3653.0 nt
GC content
0.4577

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1171.70 kcal/mol
Thermodynamic ensemble
Free energy: -1236.49 kcal/mol
Frequency: 0.0000
Diversity: 912.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.((.(((....)))(((((((((((.(((((((((((((..(.((..((((..((((.((((.....((...(.(((.((((.....))))...))))...))))))))))....))))....)).)..))))))).))))))..((((((((((((.((.((.....))....((((((((((((.(((((...........((((.((((((...((((((.(((.((.(((......(((((..(((((((.(...((((......).)))...).)).)))))..))))).....)))...)).))).)))))))))))))))))))))((((((((((((((.((.(((((((...........(((((.....)))))((((...((.((((..(((((((((((............((((...))))......(((..((.((((((((.((....(((((.((((((((((((.((.((((....(((((((((((((((..(((((((........((.((((((............)))))).)))))))))((((((((((((((.(((((((....(((....(((.(((((((((.(((((((...((.(((.........))).))((..(((((......))))).)).(((((......)))))...........(((((..(.((((((...((((.(((...((((...(((((....(((((.(((((.((((((.(((((((((..((....))...)))))))))))))))...))))))))))((((.(((((((((.(((.((.(........).)).))).)).....))))))).))))(..(((((.((((((((((.(((...))).))(((((........))))).....(((((((.(((.((..(((.....)))))))).)))).))))))))))).)))))..)...)))))))))))).))).)...)))))))))))).))))).))..)))))).....((((((...((((((.((((((((((((..((((....(((.((((((.....(((((((.....))))))))))))).))).....((((.((((((.......(((((((((.....))((((.((((((((((((((((...)))).)))).))))))))))))...................(((....))).(((((........)))))...(((((((((.((((.((((((...((......))...)))))).)))).))))))))))))))))(((((....)))))......))))))))))...))))..))))))))...)))).))))))))).)))((((((((.....((......)).....))))))))....(((.(((((....(((..(((((((..(((((((....((((...))))..(((((((((...)).....))))))).))))))).)))))))..))).((((...))))..))))).)))..))).))).))))))))))..(((....)))))))..))))))....))))......)))))).)))))))))..))))))(((((....((((((((((.((((((((....)))))..(((...((((((.(((..((((((((((.(((((((((((..((((..((((((.(((..((((...............(((.....)))((((((((.(((((...........)))))..).)))))))......(((((((.(((((((((.....))))).......(((..(((.((((((...)))))).)))..)))......)))))))))))))))..))).).))))).))))..)))).))))))).(((..(((((((((((((((((((((.....)))))))..((((((((.((((((...(((.(.(((.(((..(((......((.((((((.((((........(((..(((((..((((......))))..)))))..))).....................)))).)))))).)).....)))..))))))).))).))))))..)))))))).............((((......))))...(((((((.(((......((((((((((..((((((.......))))))(((.((((((....))))))..))).............((((.(((((((.........((((((..(((...))).))))))((((..((((((....))))))))))(((..((.(((((.....))))).)).)))....(((((((..((((..(((..(((((........))).))..)))..))))....))))))))))))))))))....))))))))))......))).)))))))..((..(((((((..(((((..((((((((.((((...(((((((((((...))))..))))))).))))...)))).)))).))))))))))))..)).))))..(((((.((......((((((((......))))))))......)).)))))..(((........))))))))))))))))))))))..............))))..))))))))).)))....))).)))))))))))))))..........)))))..)))))))..))))).))))))).))).))..)))........((((........))))..(((((.....))))).......((.((((....)))).)))))))))))))......)))).)).)))).(((((.((((.((.......)).)))).))))).(((((((((...))))).)))).((((((((....))))))))....(((((((.((.((((((.(((.....((.(((((((((((...........((...(((.((((((..((...........)).)))))).)))...))....(((.......)))........(((.((((((.(((...))).))).)))))).(((.((((((........)))))).)))))))))))))).))..))).))))))...)).)).)))))))))))).))....((((((.(((....))))))))).))))))).........(((((((.(((...))))))))))............(((((........)))))...)))))))..)))))))).))))..)).)))))))))))).(((((......)))))...(.(((((.(((((......)))))....(((((((......(((...))).....)))))))..))))).).((.(((..(((((.((....))))))).))).)).......))))))))))).)))))))))...(((((.((((((((..(((((....))))))))).))))..)))))..((((((((...........))))))))((((......(((((.....((((((((...(((((.(((((.((((((....))))))))))).)))))...))))))))....)))))......))))
Thermodynamic Ensemble Prediction
(((((({,({.(((....)))(((((((((((.(((((((((((((..(.((..((((..((((.((((.....((...,.(((.((((.....))))...))))...}}))))))))....))))....)).)..))))))).))))))..((((((((((((.((.,{....,|,....((((((((((((..{({({.{{,,,..,,|||.{(((({....||||||.,|{,.((((({,.{(((((...}})})}{{,{.(((((((((((((..,,,{{{,{(.{(||({{(((({,,{{,{,,..}))||{{,,,|},,...,))))}}.((((..,.((((((.((((((((.((({.{,{{{.....((((((.....)))))),,,..|||........((((({{(........},.))))),,...||||.,,..((((((((.((((((((,(,{{{{({,(({(,({((((({{{.(({{((({...{(((((((((({{((.....|)))))))))).{({(,,{{,...}}}|...,,},,}}),}}}}||||}|||{,,||}|||.|,,..(((((...((((,....{{(..((((((.(((((((,,...(((..(((((.((((..{{((.,(((({......)))}}.}}.(((((......)))))......,,.,.}}.}}}})))).)))))..))).{{|||{.((..||||{{,....(((((.((((({((((((.(((((((((..((....))...))))))))))))))},},,)))})))))(((({({(((,,,,}|||,||}},,,....,}|||{||}.||,,...,,,,,,,}))),..,|||||.{{||||||,,.||,||})))...,((((...}}},,}}}}},,,{,(((((((,((((({..(((,....}}}|||}}.}))).))}}))))))),))))),}|,|}}}}}}},.,,,(((((((....)).))))),},.))))),))..))))))..}}}((((((...((((((.((((((((((((..((((....(((.((((((.....(((((((.....))))))))))))).))).....((({{(((((({,.....{{{..,,((.....)}((((.((((((((((((((((...)))).)))).)))))))))))}............,.,,,..(((....))).{|||{.,......,,|||{.((((((((((.((((.((((((...((......))...)))))).)))).)))))))))),)))).{((({....}))))......})))))))))...))))..)))))))}..,)))).))))))))).)))((((((((.....((......)).....)))))))).}}}}}...}}}}}..{(((,.(((((((..(((((((.,,,{......},}},.(((((((,,..,|}...,}))))))).))))))).)))))))..}}))))),.}}))})}}|}},,,}}...)))))}..}}.)))))))).})},))))).)}},..,||||,....}}}},,,}}...,}},}})))).,)))))))).)))))}....||||,,,|||}}}}||,,|,.,,,)))}......}))))))))))}}..(((((((((.(((((((((((..((((..((((((.(((..((((...............(((.....)))((((((((.(((((...........)))))..),)))))))......(((((((.(((((((((.....)))))......,(((..(((.((((({...)))))).)))..))))}....)))))))))))))))..})).).))))).))))..)))).))))))),((({.,((((({{(((({((((((((.....)))))))}.((((((((.((((((....{(,{.((||(((..(((......{(.((((((.(((({{....,,(({..{{{((..{(({......}))}..))}||,{}}}......})},,..........)))).)))))).))..,..)))..)))))),,))}.)))))},.}))))))}.,{,,,{,{(({,{{{{,,.,..}}},...(((((((.(((...,..((((((((((..{(((((.......)))))|(((.((((((....))))))..))),............((((.(((((((........,((((((..(((...))).))))))|(((..((((((....)))))))))}{{,..((.(((({.....))))).)).)),....(((((((..((((..(((.,({(((........))).,}..)))..))))....))))))))))))))))))....))))))))))..,...))).)))))))..((..(((((((..(((((..((((((((.((((...(((((((((((...))))..))))))).))))...)))).)))).))))))))))))..)).|}}|..(((((.{{......((((((((......))))))))......}}.)))}}...||,|||,,...}})}||||||||,||,|,,,,..........,..,))))}|}||,.|{{{{{||...{((((((||||{{|{(|(||,,..,.....,}}})}})))).,,..}})},,,})))))})))}.)}}))}}}......{(((........))))..(((((.....))))),,,,,.|||}||{{....)))}|})}}}}}}}}}}},..|||||},,,},}))}.(((((.((((.({.......)).)))).))))),|{|{(((((...))))).,}}..((((((((....))))))))...{{{{((((,((,{{((((,(({...,,{,.{((((((((({..........,{({,{(((.((((((..((...........)).)))))).}}},,,}}.,,,|||,......))},,.,,...{{{.{(|(((.(((...))).))).)}|}}}.(((.((((((........)))))).))))))))))))))|)},,}}},|}||},...}}.)}.))))))))))))))}.,,,{{{({{.{{{....}}}}})}}|{{{{,{{...,,,....(((((((.(((...))))))))))..........,)))))),,,,}.},,{||...,,})))}}..)))))))).))))..)).)))))))))))).(((((......)))))...{.(((({.(((((......)))))....(((((((......{((...})).....)))))))..}}}}}.,.((.(((..(((((.((....))))))).))).)).......})))))))))).})))))))}...{((((.(((((((,.{(((((....))))))))}.))))..)))))..((((((((...........)))))))){(((...,..(((((.....((((((((...(((((.(((((.(((((,....,)))))))))).)))))...))))))))....))))),.,,..)))}

Transcripts

ID Sequence Length GC content
CUCCUACGGCAAGUCGGAGGUAGCAAGAUGGCCGCCGCUGAGGAAGGCU… 3642 nt 0.4533
GGUAGCAAGAUGGCCGCCGCUGAGGAAGGCUGUAGUGUCGGGGCCGAAG… 3653 nt 0.4577
Summary

This gene is necessary for early peroxisomal biogenesis. It acts both as a cytosolic chaperone and as an import receptor for peroxisomal membrane proteins (PMPs). Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. These disorders have at least 14 complementation groups, with more than one phenotype being observed for some complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of Zellweger syndrome (ZWS), as well as peroxisome biogenesis disorder complementation group 14 (PBD-CG14), which is also known as PBD-CGJ. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]

Forensic Context

A study in Apoe-/- mice demonstrated that cigarette smoke exposure upregulated the PEX19, a protein involved in peroxisome biogenesis, as part of a broader dysregulation of lipid and xenobiotic metabolism networks [Lo Sasso et al. DOI:10.3109/08958378.2016.1150368]. A study in Apoe-/- mice demonstrated that cigarette smoke exposure upregulated the PEX19, a protein involved in peroxisome biogenesis, as part of a broader dysregulation of lipid and xenobiotic metabolism networks [Lo Sasso et al. DOI: 10.3109/08958378.2016.1150368].