Basic Information

Symbol
PGA4
RNA class
mRNA
Alias
Pepsinogen A4 Pepsinogen 4, Group I (Pepsinogen A) Pepsinogen-4 Pepsin A-4 Pregnancy-Associated Glycoprotein EC 3.4.23.1 Pepsin A
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001079808.6
Sequence length
1384.0 nt
GC content
0.5730

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-480.60 kcal/mol
Thermodynamic ensemble
Free energy: -504.53 kcal/mol
Frequency: 0.0000
Diversity: 385.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((((((((.((((..........)))).)))))....)))))......((((((.((.(((..(((((((..(((.(.(((.(((..(((((...))))).(((....)))..((((...((((((((((((((.(((.((.....)).))))))).)..))))))))))))))))))).).)))...))))))))))..))))))))...(((((((..(((((...((.(((((.....(((...))).....))))).))....))))).....((((((...((((.(((.(((........(((((((((((((.((.((.(..((((..(((((((((((.(((((((....(((...((((((.((((((((((...............(((((....)))))..............))).......))))))).(((............)))...)).)))).))).))))))).)(((((......)))))))))))))))....(((((......)))))...))))..).)).)))))))...((((((((....(((....(((((.......(((((...(((((((((......((((............((((......)))).............))))(((...((((((((......((((.........)))).((((((((((((((.((....((....(((((((((((..(((((((...(((((((..(((........)))..)))..))))...)))))))(((.(.(((............))).).))))).)))))))))..))....)).)))))...)))))))))...))))))))...)))....((((((.(.....).)).)))).....))))))))).))))).......))))))))..))))))))..........(((((.((((((..((.((((((((........))))).))).))..))).)))....)))))..)))))))))))...)))))))....)))))).....(((((...)).)))((((((((....))))))))((((((....((((((.(((((((..(((((((..((((....(((((((.....)))))))))))..)))).)))..))))((((((((.....(((((((..(((((.....((((((.(((.........))).))))))...)))))..)))))))....)))))))).......(((((....))))).(((((((...........)))))))))).))))))....)))))).....(((.((((.......)))).))).........)))))))...
Thermodynamic Ensemble Prediction
.,,,,.((((((((({,((({,,...,,,,.}}}}.}))))...})}))),..,..{{{{{|{((.(((,.(((((((.{(((,({((({...}}|||||,,,.},,,.((({...,|{{.((((...(((((((((,((((.(((.((.....)).))))))).,..))))))))))))).)),),...)))}..)))))))}))..}|)}}}}}...{{((((({.{{{|||||((,(({{(,.,,,(((...}}|{,{{,}}}}}.||,..,||||||||..(((,,,...(((({(((....}}.{{{{{((((({{,,,((({,,..|}}}.,.((((((((((,,(,({((((((({{.,({{.,{(((({{.{{(((((((({,............,{,{{,....||}(({....,,,......,}),.....,))||||,..|},,..........||||{.||.}|||{|||.||}}|||{{(,,,.}}}..,|||||||||||||||....(((((......)))))}}})))))))).,.},)))))...((((((((....(((....(((((.....,.(((((...(((((((((.....,{(((,,..........((((......)))).....},......|||},..}||((((((((....{{(({,.....,.}}),,,.((((((((((((((.((....((,...(((((((((((.{(((((({...(((((((..(((......}.)))..))}..)))}{,,,||}|||,...|.))).}),})),,.})))),}))},.,.,))})))))..}),...)),)))))...)))))))))...))))))))..,||||...{{|||{.,....,)})).}})).....))))))))).))))).,.....))))))))..)))))))).|.....,}.(((((.((((((.{((.((((((((........)))))},)).)),.))).)))....)))))..,))))})).)}...,)))))}..},,))))).......})))).)))))}||||||||..,|||||}},.{|||||}...,{{{{|,|||{{{,..|||||||,,,{||,,,}|||||||,,,,.}}}}}}))))),,)))).))),.))))((((((((.....(((((((..(((((.....((((((.(((.........))).))))))...)))))..)))))))....)))))))).......{((((....))))},|||||{|.,,},,,.,,,)))))))))).))))}},...}}}}}}.....,{{.((((.......)))).}},.........})))))),..

Transcripts

ID Sequence Length GC content
CUGCACCUUCCUCCCAUCUUGCCUUCUCCCUCGAGUUGGGACCCGGGAA… 1384 nt 0.5730
Summary

This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer. [provided by RefSeq, Jul 2015]

Forensic Context

A study in humans demonstrated that PGA4 mRNA is a highly expressed biomarker for stomach tissue identification, with an average read count of 155,582, and was used in a targeted massively parallel sequencing assay that successfully identified tissue sources in a single-blind study [Hanson & Ballantyne DOI:10.3390/genes8110319]. The review notes that the PGA4 is part of a panel of markers used in targeted MPS assays for the definitive identification of stomach tissue, contributing to high-specificity forensic applications for organ tissue identification [Haas et al. DOI:10.1016/j.fsigen.2021.102486].