| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUGCACCUUCCUCCCAUCUUGCCUUCUCCCUCGAGUUGGGACCCGGGAA… | 1384 nt | 0.5730 |
This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that PGA4 mRNA is a highly expressed biomarker for stomach tissue identification, with an average read count of 155,582, and was used in a targeted massively parallel sequencing assay that successfully identified tissue sources in a single-blind study [Hanson & Ballantyne DOI:10.3390/genes8110319]. The review notes that the PGA4 is part of a panel of markers used in targeted MPS assays for the definitive identification of stomach tissue, contributing to high-specificity forensic applications for organ tissue identification [Haas et al. DOI:10.1016/j.fsigen.2021.102486].