| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACCUUCCUCCCAUCUUGCCUUCUCCCUCGAGUUGGGACCCGGGAAGA… | 1382 nt | 0.5695 |
This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer. [provided by RefSeq, Jul 2015]
A study in humans demonstrated that the PGA5 is expressed in stomach tissue with an average read count of 23,954 and was part of a targeted 46-plex mRNA panel for definitive organ identification using massively parallel sequencing [Hanson and Ballantyne DOI:10.3390/genes8110319]. A review further confirms the PGA5 is used in targeted MPS assays for stomach tissue identification within forensic transcriptome analyses [Haas et al. DOI:10.1016/j.fsigen.2021.102486].