| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCCCCGUCCAGAGUCCUCUGUGGUCCCUGCUGCCACCAUGGCCACUCA… | 837 nt | 0.6225 |
Phosphoglycerate mutase (PGAM) catalyzes the reversible reaction of 3-phosphoglycerate (3-PGA) to 2-phosphoglycerate (2-PGA) in the glycolytic pathway. The PGAM is a dimeric enzyme containing, in different tissues, different proportions of a slow-migrating muscle (MM) isozyme, a fast-migrating brain (BB) isozyme, and a hybrid form (MB). This gene encodes muscle-specific PGAM subunit. Mutations in this gene cause muscle phosphoglycerate mutase eficiency, also known as glycogen storage disease X. [provided by RefSeq, Sep 2009]
A study in rats demonstrated that in a model of acute right heart failure induced by pulmonary artery banding, the PGAM2 was identified as a protein with more interactive evidence in the right ventricle versus left ventricle protein-protein interaction network [Cao et al. DOI:10.1177/2045894019879396].