Basic Information

Symbol
PGK1
RNA class
mRNA
Alias
Phosphoglycerate Kinase 1 Cell Migration-Inducing Gene 10 Protein Primer Recognition Protein 2 EC 2.7.2.3 PRP 2 PGKA Epididymis Secretory Sperm Binding Protein Li 68p EC 2.7.11.1 HEL-S-68p MIG10
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Postmortem interval inference

MANE select

Transcript ID
NM_000291.4
Sequence length
4812.0 nt
GC content
0.4281

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1436.20 kcal/mol
Thermodynamic ensemble
Free energy: -1529.08 kcal/mol
Frequency: 0.0000
Diversity: 1383.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((...)))..(((.((((.((((((((.((.(((((((((..(((.....))).(((.((((((((.(((((((((.....((((...((((((((......)))).)))).))))..))))))........))).)).))))))...))))))))))))....(((((.......)))))...................((((((((.((((.((((((.(((((........))))))))))..).)))).......)))))))).((((((((...(.(((((((..(((((((.....((((.....((((((((((((((...((((((((((.........)))))..)))))....)))))(((((...)))))(((((((((((.(((((((((((((((((((((.((((((...))))))...((.(((....))))).(((((((......))))))).(((((((((((((((..(((....((((((((.(((....)))(((((..((......(((((((...))))))).......(((((((..((((.(((((((((.((.(((.((((((((((((((((((((((((((((..((((((........))))))..))..))).)))))))))...((((((..(((((((....((.(((((((((...(((((((((((.(....((.....))....)))))))...(((((((((((.((....((((..((((((((......((.(((((((((((((.((.........((.(((((((....)))))))..))...((((((.((((........).)))))))))((((.(((.....))).)))).((((...(((..(.(((.....((((....)).)).....))).)...)))...)))).)))))))))))))).).))........))))))))....(((.(((((((...((((((..((((((.(((((((((((((.((....(((((........)))))....)))))).))..))))))))))))).((.(((((((.((((...((((.(.(((((.(((....))).))))).)))))...))))..))))))))).(((..((((.((((((((((((((((..((((.((....)))))).))))))).)))).(((((((....))))))).(((.(((((((....))..))))))))..........))))).))))..))).)))))))))))))))).(((((.((((((......)))))).)))))))))....)).))))).))))))..))))).)))))...(((((((.((((.....(((((....))))).......((((((((...((((((((((((.....(((.......)))....))))))).))))))))))))))))))))))))...........)))).))....))))))).)))))).(((((.(((((..((((((.....(((((........)))))...(((((...)))))....)))))).))))).)))))..............................))))))))))))))...)))..))..)))))))))..))))....)))))))......(((((((((((((((.((((((...........)))))))))..))))))))))))....(((((...)))))(((.(((((((.((((((...(((((((.(((............((((((.((.....)).))))))(((.(((....(((((((((((((.((....(((((((.((((((((..(((..........))).)))))))).(((((..(((((..........)))))..))))).......(((........))))))))))..((....))..........(((((((((...((((........))))...)))...))))))...(((((.........))))).....)).))))......)))))))))...)))))).(((((((((......((((....)))).....)))...)))))))))))))).)).....)))))).))))))).))).....((((((((.....))))))))(((((........)))))))..))))))))))).))))).))))).))))))..))))...)))))))..............((((((........))))))..........(((.((((((((...((...((((.((((...((((((((((..(((.(((.((((...)))).))).)))...........(((((((((((((..((((((((((((((..((((((....(((((((((.......(((((((........)))))))...(((((((((((((.((((..(((((((((.......)))))...........))))...))))..)))))((((((((.(.((.((..(((((((((.((((.((((((.........))))))...(((((((((((((.(((.(((((((((((...((....((((((...((........))(((((.....)))))(((((((..(((((((.((((..(((...((((((.(((((((((...((....((((((...))))))))...)))))...(((((..((((....((((..((.....(((((............)))))..)).)))).....))))..))))).....((((((.(((((.(((..((((((((.(((....))).))))))).................((((((((.....(((((((((((((.......)))....))))))))))..)))))))).......(((((....(((((((..((((..........))))..)))))))..))))).)..))).))))).))))))....((((((...((((((....((((.(((((.((((((((((...(((((((......)))....(((.(((.((.((...........)).)).))).)))....((.((.((((.....)))).)).))..))))..))))))).).)).))))))))).((((((((((((....))))))))))))(((((.....)))))))))))..))))))......((((((((((....)))))))))).........(((((......))))).(((((((((..(((((........................)))))......)))))))))..(((((....(((((((...))).))))..))))).........(((((.((((......................))))...)))))...................))))))))))...))).................................((((((....................(((((.....)))))(((..((((((((((.((((((((...))))))))))))))..))))..)))..))))))........(((((.....)))))........(((((((((((..((........)).)))))))))))...((((((....))))))..(((.........))).......)))).)))))))...)))))))((......))...........))))))))((((((((((((.((((((.....((((((....))))))..(((((...(((((.....))))).....))))).(((((((((((.....(((((((((...))))).))))...............))))))).)))))))))).)))))))).))))(((((........))))))))))))))......)).))).))))))))))))).((((((.(((((....)).)))))))))....)))).)))))))))))))).))))))))..........................)))))))))))).)))))))))))....)))))))))))((((....))))(((((((..(((........)))....)))))))...................)))..)))))))))))))...............)))))))))).)))))))).)).)))))))))))......))))))))))))))............((.....)))))))))))))........))))))))).....((((....))))...................(((((........)))))......(((((((......))))))).....)))).........)))))))..))))))).)...)))))))).(((((...((((((.......))))))....)))))(((((((((((..((((((((...........))))))))......))))...)))))))....................((((((((..((..(((....)))..))..))))))))((((.(..(((.((((.((((..((((((((..((.((..(((.....)))......)).)).)))))))).....)))).)))).)))..)..)))).((((......))))....)).)))))))).))........................(((((((.(((......))).)))))))...............)).))).
Thermodynamic Ensemble Prediction
.....(({...|}}..(((.((((.((((((((,((.{((((((({.,((({{(({{,..{{,,(((((({{.(({((((((.....((((...((((((((......)))).)))).))))..))))))........)))},}.))))))..,))}))))))))}....(((((.......)))))...................{(((((({.((((.(((({(((((((........))))))))))..).)))).......)))))))}.{(((((((...(.(((((((,,{{{{{{|,,,.,(((({{{,,((,,,{,,(((({({,{(,(((({{{{.......{{|||||{{|||},,.,,|||||,,,,,...))))),||,|{{|||||{,{|||||||,,{{..||||..,{||||}.,))))})})).|,|{{,,{{||||{.(((((((......))))))).,{,,{(({{((((....{(({{{{((((({,,,(((....||,{(({{,,({......(((((((...)))))))...,,.,,{{{{{{||||{{,{{{{{((((,((,(((,(((((((((((((({(((((((((((({..((((((,......,))))))..),.})))}})))))))}...((((((..(((((((....((.(((((((((...(((({((((((.{.,.,{,.....)),..,})))))),,.(((((((((((.((....((((,.((((((((......((.(((((((((((((,,{,,..{,.{{(({{{((((,.{{,|||||||{,},..,|||||{{(,.{....,,||}.{{{{{.||(((({.{{,...}})})))},))))},.,,|||..,|{||.....}}||..,}}},,,,....|||{,...,..}))),,,,}})))))))))))).).))........))))))))....(((((((((((...((((((.,((((((.((((((({((((,{((....(((((........)))))....))))))}.}..))))))))))))),{{.(((((((.((((...((,(.(.(((((.(((....))).))))).}}))},..))))..)))))))}}.(((..((((.(((((,((((((((((,.((((.((....)})))).}}))))),)),}.(((((((....))))))).{{{.(((({((....))..)))))}}|......}),.))))).))))..))).)))))))))))))))).{((((.((((((......)))))).)))))))))..}.)).))))).)))))).,})))).))))}...(((((((.((((.....(((((....))))).......((((((({..,((((((((((((.,,..{({.......}}).}}.))))))),})))))))))))))))))))))))..........,)))).))....))))))).)))))).(((((.(((((..((((((.....((((({......,)))))...,{{{(,..}}}}}....)))))).))))).)))))..........,,{{........,,,,,...)))))))))))|||,,,|}},,,,..,}))}})))}}}},,.,,,|}}},,,.}}}|.(((((((((((({{(.((((((.,.....,...))))))}))..))))))))))))...,{({{{...})))}|,,.,,,,,||}||||||,,}||||,,,,{{({{{{{,{{,{,{((((((.((.....)).))))))|||.|||},.,|||||{(((((((.((,,,,{{{{,((,(((((,.({{((.{(((({((((({{.,,||,((({(((((..(((((.{{.....}.)))))..))))}....,,,(((........||},,,}}}},,||}.,,}}|,,.....,.(((((((,,,{.((((........))))...})..,.))))))...(((((.........)))))..||||}.|||||||..,..}}}},,,..,|||,,,{(((,(((......}}|.}}}}.}))}.....{|||....}}}}|||||,,,,,{{{{,..,))))),,,,}},}.}}},....{(((((((.....)))))))}.............})))))),,)))))}}})))})......,)))})))))))})))...}))))|||,,.{{{........{(((((.,,,....}}}}}}||,|}||,,,||.{{{(((({{,||||..,{{{{,{({{.||{(((({{{{|},|{{.||{.{|||..,)))),}}}.}}},,,........{{{{(({{{{{{{..|{{{{{{(((({{{,.{{{{{{..,,(((((((((..,{{{,(((((((........)))))))...,{{{{{{,{(({({{{{({{((({(((((....,|,||}}}}..........{||||,.,,{|{{,,,,.|}}}|||,}|}||{{{.{((({{({{{,(({,..{{{{,...,,.,,,|||{||,,.,,,,{,{((((((,{{,,{{{((({{{{,,,.|||...,{{{,,...,,....{(((({(((((.....))))}|}.})))}.,,,,{{{{{{{{,,{||.,||||{||.{||||||{{,,.|||,,.||{(({...,}}}}},|,,.,||},,|.,,,|}},|||,.{{{.{.,,.,,|||,.(((((.,........,.))))),{{{|.{{{.....))),))))}|||,...((((((.(((((.(({..((((((((.(((....))).)))))))}..,,,,..........((((((((.....((((((((({(((.......)))....})))))))))..)))))))).}}}}..{({{{....(((((((..((((..........))))..)))))))..))))}.,..})).))))).))))))..,,,{{|||.,,||||||}}}}||||,{|||{.{{||||||||...,{{(((({....|)))|...(((.(((.((.((...........)).)).))),)))....({.((.((((.....)))).)).))..)))),,)}}}}}),),)},))))))))),((((((((((((....)))))))))))){{{{{....,)))))))))))},}},,,,......{(((((((((....)))))))))}.........(((((......))))).(((((((((..(((((..,,,...............,},.))))).,....)))))))))..(((((....(((((({...})).))))..)))))..,,....,|||||,|{{{..,,{{,,,......,}}.,,,))))...)}})),}}},,....}}}}.....}}},|||,,|,,.,,}......|||,.......,,,.............,((,,((((.......))))..}}..(((((.....))))){{{..{(((((((((,((((((((...)))))))}}))))),,))))}.}))},))))},......,,|||||.....)))),.....,,.(((((((((((.{((........)).)))))))))))...((((({....))))))..{((.........}}}......,||||||||||||||.,,}}}}|||,,,,|}}|}}},,,}}},,}}})||{{{((({{(((((({{.(((((....((((({....})))))..,,.))))){{{||.,,,,))))).,}||}}|||{{(||(((((((.....(((((((((...))))).))))............,|.))))))).||||(((,,,.))))))},.)}))}||||,.,,,},,)}}|||||||||||..{{{{{{...|{||||}}}}|||{|.((((((,{((((....)).))))))))),}))},))}))).,.||)})))).,)))))))))}.........,,||,.......,}}}}}}}}}))))}}})}}}|||}},...}})}}}}}}}}({({....|||}(((((((..(((........)))....))))))).....,,.{{.......}}}}},,))))))))}}}},............,,.}}}}}}}}}},,}},}}))}},.)}))}))))||,||||,}||||,}||||}}}..,,....,,{,.......)))))))),,,,},,,.....,})))},}}.,...{{{{,...)))),||||||,||},,|,....{{{{(....,,,,))))).....,(((((((......))))))}.....}|||,.,,,,,,.,}})))),,})))))),)...)))))))}.(((((...((((((.......))))))....)))))((({(((((((,.((((((((,........,.))))))))..,...))))..,)))))))....................((((((((..((..(((....)))..))..))))))))|||{}},,|||.{(((.((((..((((((((.,{(,({..((({...|}}}..,...)).}).)))))))).,...)))).)))),)))..}.|}}}}.{{||......))))|,|||,.,})))))).))....,,,,,,.,|,,,,.,.,,,.{(({(({.(({......))).))))))).,,......}},...)).))).

Transcripts

ID Sequence Length GC content
GUUCCGCAUUCUGCAAGCCUCCGGAGCGCACGUCGGCAGUCGGCUCCCU… 4812 nt 0.4281
Summary

The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. The encoded protein may also act as a cofactor for polymerase alpha. Additionally, this protein is secreted by tumor cells where it participates in angiogenesis by functioning to reduce disulfide bonds in the serine protease, plasmin, which consequently leads to the release of the tumor blood vessel inhibitor angiostatin. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Deficiency of the enzyme is associated with a wide range of clinical phenotypes hemolytic anemia and neurological impairment. Pseudogenes of this gene have been defined on chromosomes 19, 21 and the X chromosome. [provided by RefSeq, Jan 2014]

Forensic Context

A study in humans demonstrated that phosphoglycerate kinase 1 (PGK1) is a housekeeping gene with robust and consistent expression across forensic body fluid stains including saliva, blood, vaginal secretion, and menstrual blood, showing similar expression to ACTB in several fluids and to PPIA and B2M in semen [Moreno et al. DOI:10.1111/j.1556-4029.2012.02086.x]. Another human study utilized PGK1 as an endogenous reference gene to equalize input amounts of cDNA prior to body fluid identification profiling via MALDI-TOF mass spectrometry, where it exhibited consistent expression levels among venous blood, saliva, and semen and was selected as an adequate control for the assay [Donfack & Wiley DOI:10.1016/j.fsigen.2014.12.008]. A review of post-mortem interval estimation noted that in rat retinal cells, decreasing levels of Pgk1 mRNA showed a linear correlation with the post-mortem interval [Scrivano et al. DOI:10.1007/s00414-019-02125-x].