| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAAGGCGUUAGAAGUCACCACCGACCCAGCCCCUCAACAGCAAGUUGGU… | 1626 nt | 0.4539 |
This gene is intronless, arose via retrotransposition of the phosphoglycerate kinase 1 gene, and is expressed specifically in the testis. Initially assumed to be a pseudogene, the encoded protein is actually a functional phosphoglycerate kinase that catalyzes the reversible conversion of 1,3-bisphosphoglycerate to 3-phosphoglycerate, during the Embden-Meyerhof-Parnas pathway of glycolysis, in the later stages of spermatogenesis.[provided by RefSeq, May 2010]
A study in humans demonstrated that in skeletal muscle, the PGK2 protein exhibited higher expression in heavier co-twins compared to their leaner monozygotic twins, which was associated with upregulated glycolysis pathways in acquired obesity [van der Kolk et al. DOI:10.1016/j.xcrm.2021.100226].