Basic Information

Symbol
PGLYRP1
RNA class
mRNA
Alias
Peptidoglycan Recognition Protein 1 PGRP-S PGRP TNFSF3L PGLYRP PGRPS TAG7 TNF Superfamily, Member 3 (LTB)-Like (Peptidoglycan Recognition Protein) Peptidoglycan Recognition Protein Short Peptidoglycan Recognition Protein
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005091.3
Sequence length
708.0 nt
GC content
0.6201

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-285.00 kcal/mol
Thermodynamic ensemble
Free energy: -295.36 kcal/mol
Frequency: 0.0000
Diversity: 125.79
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((((...))))).(((((.(((.(((((.(((.(((..((.(((((((((..(((((((((((((..((((..(((((...))))).))))..))))).....).)))))...)).)))))...)))).))..))).)))))))).)))...)))))((((.((((.....))))))))(((.((((.....((((((((((((...(((((...(((((.((.((((...(((.........))).)))).))..)))))...)))))...))))))))))..)).....)))).)))))....(((((((((.(((....((((((((((((((.((((....))))((((((((..((........((((((....((((.......((((....))))((((((.(((....)))..)))))).......(((((.(((((.(((((((.(((((((((((((...))).))).....))))))).)))))))((((((....))))))((((...............))))...(((((((((...))))).))))....(((.....)))....))))).))))).....((((.((.............)).))))...))))...)))))).........))..))))))))..........))))))...)))))))).))).)))))))))...
Thermodynamic Ensemble Prediction
.({(((((...))))).{((((,(({.(((((.(((.(((..((.(((((((((..((({(((((((((..((((..(((((...))))).))))..))))}.....).))))),..},.)))))...)))).))..))).})}))))).|||...,|||,((((.((((.....))))))))|||.{{|{...,,|(((((((((((...(((((...(((((.((.((((,..({{.........))).)))).))..)))))...)))))...)))))))))),..).,...)))).))}))....(((((((((.(((....((((((((((((((,((((....))))((((((((..((........((((((,,....,||...|..,{|{....},,|((((((.(((....)))..))))))}.......((((,((({(,(((((((.(((((((((((((...))).))),....})))))).)))))))(((((({{{{||||}|((((......,........))))..,|||{(((((...))))).}}}}....(((.....)}},...||}}|,,.,,}},..}||..........)}}},},,))))))},.,}}))}}})))))).........))..))))))))..........)))))}..,)))))))).})).)))))))))...

Transcripts

ID Sequence Length GC content
AGCGGUCUCCCGGACCCUGCCGCCCUGCCACUAUGUCCCGCCGCUCUAU… 708 nt 0.6201
Summary

Enables several functions, including Hsp70 protein binding activity; peptidoglycan binding activity; and peptidoglycan immune receptor activity. Involved in antimicrobial humoral immune response mediated by antimicrobial peptide; defense response to Gram-positive bacterium; and detection of bacterium. Located in extracellular exosome. Is active in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans identified the PGLYRP1 as a potential diagnostic biomarker for burn injury, where it was significantly up-regulated in patient blood samples and validated as one of twelve key immune-related genes through bioinformatics analysis and qRT-PCR [Niu et al. DOI:10.1093/jbcr/irad050]. Separately, a human study surveying plasma microRNA transcriptomes for acute myocardial infarction mentioned the PGLYRP1 in its introduction as a proposed diagnostic protein reported to be more sensitive and specific for early-stage STEMI than traditional markers, though it was not experimentally studied within that investigation [Wang et al. DOI:10.1186/s40364-024-00690-x].