| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCGGUCUCCCGGACCCUGCCGCCCUGCCACUAUGUCCCGCCGCUCUAU… | 708 nt | 0.6201 |
Enables several functions, including Hsp70 protein binding activity; peptidoglycan binding activity; and peptidoglycan immune receptor activity. Involved in antimicrobial humoral immune response mediated by antimicrobial peptide; defense response to Gram-positive bacterium; and detection of bacterium. Located in extracellular exosome. Is active in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans identified the PGLYRP1 as a potential diagnostic biomarker for burn injury, where it was significantly up-regulated in patient blood samples and validated as one of twelve key immune-related genes through bioinformatics analysis and qRT-PCR [Niu et al. DOI:10.1093/jbcr/irad050]. Separately, a human study surveying plasma microRNA transcriptomes for acute myocardial infarction mentioned the PGLYRP1 in its introduction as a proposed diagnostic protein reported to be more sensitive and specific for early-stage STEMI than traditional markers, though it was not experimentally studied within that investigation [Wang et al. DOI:10.1186/s40364-024-00690-x].